EMAIL THIS PAGE TO A FRIEND

ARL14EP

ADP-ribosylation factor-like 14 effector protein

73 Gene Product Result for
Synonyms: ARF7EP C11orf46 dJ299F11.1
UniProtKB ID: Q8N8R7, Q5HYH9
Gene ID:
Mouse(212772) ADP-ribosylation factor-like 14 effector protein
Rat(311279) ADP-ribosylation factor-like 14 effector protein
Zebrafish(751672) ADP-ribosylation factor-like 14 effector protein
dog(475958) ADP-ribosylation factor-like 14 effector protein
cow(523894) chromosome 15 open reading frame, human C11orf46
domestic cat(101085239) ADP-ribosylation factor-like 14 effector protein
domestic guinea pig(100726262) ADP-ribosylation factor-like 14 effector protein
naked mole-rat(101707225) ADP-ribosylation factor-like 14 effector protein
sheep(101118726) ADP-ribosylation factor-like 14 effector protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173750 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173750 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173750 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152316 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152316 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152316 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110421 MISSION® esiRNA esiRNA human C11orf46 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152316 Rosetta Predictions human pricing
NM_001014045 Rosetta Predictions rat pricing
NM_001025102 Rosetta Predictions mouse pricing
NM_173750 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152316 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195083 predicted 797
2 SASI_Hs01_00195084 predicted 728
3 SASI_Hs01_00195085 predicted 882
4 SASI_Hs01_00195086 predicted 713
5 SASI_Hs01_00195087 predicted 933
6 SASI_Hs01_00195088 predicted 880
7 SASI_Hs02_00365904 predicted 913
8 SASI_Hs01_00195089 predicted 878
9 SASI_Hs01_00195090 predicted 947
10 SASI_Hs01_00195091 predicted 715
11 SASI_Hs01_00195092 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014045 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086888 predicted 991
2 SASI_Rn01_00086890 predicted 220
3 SASI_Rn01_00086891 predicted 234
4 SASI_Rn01_00086892 predicted 319
5 SASI_Rn01_00086893 predicted 825
6 SASI_Rn02_00201436 predicted 647
7 SASI_Rn01_00086894 predicted 242
8 SASI_Rn01_00086895 predicted 991
9 SASI_Rn01_00086896 predicted 812
10 SASI_Rn01_00086897 predicted 818
11 SASI_Rn01_00086889 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025102 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153099 predicted 733
2 SASI_Mm01_00153100 predicted 348
3 SASI_Mm01_00153101 predicted 858
4 SASI_Mm02_00287775 predicted 900
5 SASI_Mm01_00153102 predicted 549
6 SASI_Mm01_00153103 predicted 938
7 SASI_Mm01_00153104 predicted 910
8 SASI_Mm02_00287776 predicted 948
9 SASI_Mm01_00153105 predicted 498
10 SASI_Mm01_00153106 predicted 408
11 SASI_Mm01_00153107 predicted 1060
12 SASI_Mm01_00153108 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173750 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124627 predicted 690
2 SASI_Mm01_00124628 predicted 300
3 SASI_Mm01_00124629 predicted 809
4 SASI_Mm02_00345393 predicted 850
5 SASI_Mm01_00124630 predicted 507
6 SASI_Mm01_00124631 predicted 885
7 SASI_Mm01_00124632 predicted 864
8 SASI_Mm02_00345394 predicted 896
9 SASI_Mm01_00124633 predicted 445
10 SASI_Mm01_00124634 predicted 360
11 SASI_Mm01_00124635 predicted 1021
12 SASI_Mm01_00124636 predicted 420
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173750
VALIDATED
ARL14EP MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 14 effector protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173750.2-514s21c1
Sequence:CCGGTGGAAGTGTGGACGTTGATTCCTCGAGGAATCAACGTCCACACTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173750.2-361s21c1
Sequence:CCGGGTCGTGTTGTGACCCATTTAACTCGAGTTAAATGGGTCACAACACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173750.2-890s21c1
Sequence:CCGGGGAGGAGAGATAATCCATAATCTCGAGATTATGGATTATCTCTCCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173750.2-285s21c1
Sequence:CCGGTGACACTTTCTGGGAATAATACTCGAGTATTATTCCCAGAAAGTGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173750.2-1148s21c1
Sequence:CCGGGATGGAAACTTAACCCACATTCTCGAGAATGTGGGTTAAGTTTCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173750.1-1060s1c1
Sequence:CCGGCCTGAATGGAATTGTAGACATCTCGAGATGTCTACAATTCCATTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173750.1-621s1c1
Sequence:CCGGCAAACTGAATTTGCTCCAGAACTCGAGTTCTGGAGCAAATTCAGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173750.1-1149s1c1
Sequence:CCGGGATGGAAACTTAACCCACATTCTCGAGAATGTGGGTTAAGTTTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173750.1-708s1c1
Sequence:CCGGCCAGCAAAGAGTAAGGTGTATCTCGAGATACACCTTACTCTTTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173750
VALIDATED
ARL14EP MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 14 effector protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173750.2-514s21c1
Sequence:CCGGTGGAAGTGTGGACGTTGATTCCTCGAGGAATCAACGTCCACACTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173750.2-361s21c1
Sequence:CCGGGTCGTGTTGTGACCCATTTAACTCGAGTTAAATGGGTCACAACACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173750.2-890s21c1
Sequence:CCGGGGAGGAGAGATAATCCATAATCTCGAGATTATGGATTATCTCTCCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173750.2-285s21c1
Sequence:CCGGTGACACTTTCTGGGAATAATACTCGAGTATTATTCCCAGAAAGTGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173750.2-1148s21c1
Sequence:CCGGGATGGAAACTTAACCCACATTCTCGAGAATGTGGGTTAAGTTTCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173750.1-1060s1c1
Sequence:CCGGCCTGAATGGAATTGTAGACATCTCGAGATGTCTACAATTCCATTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173750.1-621s1c1
Sequence:CCGGCAAACTGAATTTGCTCCAGAACTCGAGTTCTGGAGCAAATTCAGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173750.1-1149s1c1
Sequence:CCGGGATGGAAACTTAACCCACATTCTCGAGAATGTGGGTTAAGTTTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173750.1-708s1c1
Sequence:CCGGCCAGCAAAGAGTAAGGTGTATCTCGAGATACACCTTACTCTTTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173750
VALIDATED
ARL14EP MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 14 effector protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173750.2-514s21c1
Sequence:CCGGTGGAAGTGTGGACGTTGATTCCTCGAGGAATCAACGTCCACACTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173750.2-361s21c1
Sequence:CCGGGTCGTGTTGTGACCCATTTAACTCGAGTTAAATGGGTCACAACACGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173750.2-890s21c1
Sequence:CCGGGGAGGAGAGATAATCCATAATCTCGAGATTATGGATTATCTCTCCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173750.2-285s21c1
Sequence:CCGGTGACACTTTCTGGGAATAATACTCGAGTATTATTCCCAGAAAGTGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173750.2-1148s21c1
Sequence:CCGGGATGGAAACTTAACCCACATTCTCGAGAATGTGGGTTAAGTTTCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173750.1-1060s1c1
Sequence:CCGGCCTGAATGGAATTGTAGACATCTCGAGATGTCTACAATTCCATTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173750.1-621s1c1
Sequence:CCGGCAAACTGAATTTGCTCCAGAACTCGAGTTCTGGAGCAAATTCAGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173750.1-1149s1c1
Sequence:CCGGGATGGAAACTTAACCCACATTCTCGAGAATGTGGGTTAAGTTTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173750.1-708s1c1
Sequence:CCGGCCAGCAAAGAGTAAGGTGTATCTCGAGATACACCTTACTCTTTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152316
VALIDATED
ARL14EP MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 14 effector protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152316.1-481s1c1
Sequence:CCGGGAAGACAGCTTGTACCTGGTTCTCGAGAACCAGGTACAAGCTGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_152316.1-520s1c1
Sequence:CCGGGCACACAGATAATCAATGGAACTCGAGTTCCATTGATTATCTGTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152316.1-199s1c1
Sequence:CCGGGTACTACAAATGAGTGCCATACTCGAGTATGGCACTCATTTGTAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134139    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152316.1-1573s1c1
Sequence:CCGGCAAAGATGAAAGTGCAGCAAACTCGAGTTTGCTGCACTTTCATCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_152316.1-732s1c1
Sequence:CCGGGCAAAGAGTAAGGTCTATGATCTCGAGATCATAGACCTTACTCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152316.1-600s1c1
Sequence:CCGGGCTAAAGCTTTGAGGTCATTACTCGAGTAATGACCTCAAAGCTTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152316.1-380s1c1
Sequence:CCGGGAAGTCATGTTGTGACCCATTCTCGAGAATGGGTCACAACATGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152316.1-641s1c1
Sequence:CCGGGCAAACTGAATTTGCTCCAGACTCGAGTCTGGAGCAAATTCAGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_152316.1-1182s1c1
Sequence:CCGGGCAGTCCTCTATTTGCATGTTCTCGAGAACATGCAAATAGAGGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152316
VALIDATED
ARL14EP MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 14 effector protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152316.1-481s1c1
Sequence:CCGGGAAGACAGCTTGTACCTGGTTCTCGAGAACCAGGTACAAGCTGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_152316.1-520s1c1
Sequence:CCGGGCACACAGATAATCAATGGAACTCGAGTTCCATTGATTATCTGTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152316.1-199s1c1
Sequence:CCGGGTACTACAAATGAGTGCCATACTCGAGTATGGCACTCATTTGTAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134139    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152316.1-1573s1c1
Sequence:CCGGCAAAGATGAAAGTGCAGCAAACTCGAGTTTGCTGCACTTTCATCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_152316.1-732s1c1
Sequence:CCGGGCAAAGAGTAAGGTCTATGATCTCGAGATCATAGACCTTACTCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152316.1-600s1c1
Sequence:CCGGGCTAAAGCTTTGAGGTCATTACTCGAGTAATGACCTCAAAGCTTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152316.1-380s1c1
Sequence:CCGGGAAGTCATGTTGTGACCCATTCTCGAGAATGGGTCACAACATGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152316.1-641s1c1
Sequence:CCGGGCAAACTGAATTTGCTCCAGACTCGAGTCTGGAGCAAATTCAGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_152316.1-1182s1c1
Sequence:CCGGGCAGTCCTCTATTTGCATGTTCTCGAGAACATGCAAATAGAGGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152316
VALIDATED
ARL14EP MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 14 effector protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152316.1-481s1c1
Sequence:CCGGGAAGACAGCTTGTACCTGGTTCTCGAGAACCAGGTACAAGCTGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_152316.1-520s1c1
Sequence:CCGGGCACACAGATAATCAATGGAACTCGAGTTCCATTGATTATCTGTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152316.1-199s1c1
Sequence:CCGGGTACTACAAATGAGTGCCATACTCGAGTATGGCACTCATTTGTAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134139    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152316.1-1573s1c1
Sequence:CCGGCAAAGATGAAAGTGCAGCAAACTCGAGTTTGCTGCACTTTCATCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_152316.1-732s1c1
Sequence:CCGGGCAAAGAGTAAGGTCTATGATCTCGAGATCATAGACCTTACTCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152316.1-600s1c1
Sequence:CCGGGCTAAAGCTTTGAGGTCATTACTCGAGTAATGACCTCAAAGCTTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152316.1-380s1c1
Sequence:CCGGGAAGTCATGTTGTGACCCATTCTCGAGAATGGGTCACAACATGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152316.1-641s1c1
Sequence:CCGGGCAAACTGAATTTGCTCCAGACTCGAGTCTGGAGCAAATTCAGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_152316.1-1182s1c1
Sequence:CCGGGCAGTCCTCTATTTGCATGTTCTCGAGAACATGCAAATAGAGGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)