EMAIL THIS PAGE TO A FRIEND

ARL14EPL

ADP-ribosylation factor-like 14 effector protein-like

60 Gene Product Result for
UniProtKB ID: P0DKL9
Gene ID:
Mouse(381142) ADP-ribosylation factor-like 14 effector protein-like
Rat(685394) ADP-ribosylation factor-like 14 effector protein-like
sheep(101107869) ADP-ribosylation factor-like 14 effector protein-like
naked mole-rat(101719872) ADP-ribosylation factor-like 14 effector protein-like
domestic guinea pig(100720446) ADP-ribosylation factor-like 14 effector protein-like
chicken(100858213) ADP-ribosylation factor-like 14 effector protein-like
dog(100683384) ADP-ribosylation factor-like 14 effector protein-like
domestic cat(101090834) ADP-ribosylation factor-like 14 effector protein-like
cow(616348) ADP-ribosylation factor-like 14 effector protein-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033446 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033446 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033446 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU198701 MISSION® esiRNA esiRNA targeting mouse Gm949 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001716906 Rosetta Predictions human pricing
XM_927327 Rosetta Predictions human pricing
XM_937388 Rosetta Predictions human pricing
XM_001063624 Rosetta Predictions rat pricing
NM_001033446 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716906 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00413736 predicted 236
2 SASI_Hs02_00413737 predicted 230
3 SASI_Hs02_00413738 predicted 196
4 SASI_Hs02_00413739 predicted 32
5 SASI_Hs02_00413740 predicted 330
6 SASI_Hs02_00413741 predicted 27
7 SASI_Hs02_00413742 predicted 143
8 SASI_Hs02_00413743 predicted 287
9 SASI_Hs02_00413744 predicted 259
10 SASI_Hs02_00413745 predicted 191
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927327 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00480534 predicted 229
2 SASI_Hs02_00480535 predicted 232
3 SASI_Hs02_00480536 predicted 195
4 SASI_Hs02_00480537 predicted 34
5 SASI_Hs01_00273164 predicted 334
6 SASI_Hs02_00480538 predicted 32
7 SASI_Hs01_00273165 predicted 141
8 SASI_Hs01_00273167 predicted 285
9 SASI_Hs01_00273168 predicted 261
10 SASI_Hs01_00273169 predicted 188
11 SASI_Hs01_00273166 predicted 217
12 SASI_Hs01_00273170 predicted 15
13 SASI_Hs01_00273171 predicted 84
14 SASI_Hs01_00273172 predicted 74
15 SASI_Hs01_00273173 predicted 67
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_937388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482586 predicted 235
2 SASI_Hs02_00482587 predicted 229
3 SASI_Hs02_00482588 predicted 198
4 SASI_Hs02_00482589 predicted 29
5 SASI_Hs02_00482590 predicted 332
6 SASI_Hs02_00482591 predicted 35
7 SASI_Hs02_00482592 predicted 140
8 SASI_Hs02_00482593 predicted 279
9 SASI_Hs02_00482594 predicted 257
10 SASI_Hs02_00482595 predicted 194
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063624 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307847 predicted 228
2 SASI_Rn02_00307848 predicted 199
3 SASI_Rn02_00307849 predicted 233
4 SASI_Rn02_00307850 predicted 229
5 SASI_Rn02_00307851 predicted 200
6 SASI_Rn02_00307852 predicted 275
7 SASI_Rn02_00307853 predicted 193
8 SASI_Rn02_00307854 predicted 328
9 SASI_Rn02_00307855 predicted 104
10 SASI_Rn02_00307856 predicted 42
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033446 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108539 predicted 1088
2 SASI_Mm01_00108540 predicted 222
3 SASI_Mm01_00108541 predicted 239
4 SASI_Mm01_00108542 predicted 357
5 SASI_Mm01_00108543 predicted 285
6 SASI_Mm01_00108544 predicted 1086
7 SASI_Mm01_00108545 predicted 222
8 SASI_Mm01_00108546 predicted 1001
9 SASI_Mm01_00108547 predicted 996
10 SASI_Mm01_00108548 predicted 429
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033446
ARL14EPL MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 14 effector protein-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033446.2-295s21c1
Sequence:CCGGAGATAGAACGGCAGCTAAAGTCTCGAGACTTTAGCTGCCGTTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033446.2-225s21c1
Sequence:CCGGACTCAACAGGAGCTCACTAACCTCGAGGTTAGTGAGCTCCTGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033446.2-1235s21c1
Sequence:CCGGTGGTCGAGAACACCGTAATTTCTCGAGAAATTACGGTGTTCTCGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033446.2-619s21c1
Sequence:CCGGTCATCAACACCCTGCCATTTACTCGAGTAAATGGCAGGGTGTTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033446.2-388s21c1
Sequence:CCGGCGCGGATGTCAAAGATGAATGCTCGAGCATTCATCTTTGACATCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033446
ARL14EPL MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 14 effector protein-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033446.2-295s21c1
Sequence:CCGGAGATAGAACGGCAGCTAAAGTCTCGAGACTTTAGCTGCCGTTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033446.2-225s21c1
Sequence:CCGGACTCAACAGGAGCTCACTAACCTCGAGGTTAGTGAGCTCCTGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033446.2-1235s21c1
Sequence:CCGGTGGTCGAGAACACCGTAATTTCTCGAGAAATTACGGTGTTCTCGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033446.2-619s21c1
Sequence:CCGGTCATCAACACCCTGCCATTTACTCGAGTAAATGGCAGGGTGTTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033446.2-388s21c1
Sequence:CCGGCGCGGATGTCAAAGATGAATGCTCGAGCATTCATCTTTGACATCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033446
ARL14EPL MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 14 effector protein-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033446.2-295s21c1
Sequence:CCGGAGATAGAACGGCAGCTAAAGTCTCGAGACTTTAGCTGCCGTTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033446.2-225s21c1
Sequence:CCGGACTCAACAGGAGCTCACTAACCTCGAGGTTAGTGAGCTCCTGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033446.2-1235s21c1
Sequence:CCGGTGGTCGAGAACACCGTAATTTCTCGAGAAATTACGGTGTTCTCGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033446.2-619s21c1
Sequence:CCGGTCATCAACACCCTGCCATTTACTCGAGTAAATGGCAGGGTGTTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033446.2-388s21c1
Sequence:CCGGCGCGGATGTCAAAGATGAATGCTCGAGCATTCATCTTTGACATCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks