EMAIL THIS PAGE TO A FRIEND

ARL15

ADP-ribosylation factor-like 15

153 Gene Product Result for
Synonyms: ARFRP2
UniProtKB ID: Q9NXU5, Q6IAD0
Gene ID:
Mouse(218639) ADP-ribosylation factor-like 15
Rat(689079) ADP-ribosylation factor-like 15
chicken(769515) ADP-ribosylation factor-like 15
dog(489204) ADP-ribosylation factor-like 15
cow(534329) ADP-ribosylation factor-like 15
domestic cat(101088982) ADP-ribosylation factor-like 15
naked mole-rat(101698972) ADP-ribosylation factor-like 15
sheep(101118640) ADP-ribosylation factor-like 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172595 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172595 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172595 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019087 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019087 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019087 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019087 Rosetta Predictions human pricing
XM_001069431 Rosetta Predictions rat pricing
NM_172595 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038513 predicted 845
2 SASI_Hs01_00038514 predicted 838
3 SASI_Hs01_00038515 predicted 859
4 SASI_Hs02_00352686 predicted 699
5 SASI_Hs01_00038516 predicted 642
6 SASI_Hs01_00038517 predicted 885
7 SASI_Hs01_00038518 predicted 358
8 SASI_Hs01_00038519 predicted 398
9 SASI_Hs01_00038520 predicted 864
10 SASI_Hs01_00038522 predicted 898
11 SASI_Hs01_00038521 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069431 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328032 predicted 862
2 SASI_Rn02_00328033 predicted 804
3 SASI_Rn02_00328034 predicted 295
4 SASI_Rn02_00328035 predicted 295
5 SASI_Rn02_00328036 predicted 342
6 SASI_Rn02_00328037 predicted 845
7 SASI_Rn02_00328038 predicted 853
8 SASI_Rn02_00328039 predicted 816
9 SASI_Rn02_00328040 predicted 899
10 SASI_Rn02_00328041 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172595 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200540 predicted 402
2 SASI_Mm01_00200541 predicted 978
3 SASI_Mm01_00200542 predicted 887
4 SASI_Mm01_00200543 predicted 745
5 SASI_Mm01_00200544 predicted 911
6 SASI_Mm01_00200545 predicted 804
7 SASI_Mm01_00200546 predicted 865
8 SASI_Mm02_00344290 predicted 556
9 SASI_Mm01_00200547 predicted 314
10 SASI_Mm01_00200548 predicted 951
11 SASI_Mm01_00200549 predicted 806
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172595
ARL15 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 15
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172595.4-697s21c1
Sequence:GTACCGGAGCTTCTCCCAGCTCATAAACCTCGAGGTTTATGAGCTGGGAGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172595.4-396s21c1
Sequence:GTACCGGAGCTGACAATATCCGGAAATACTCGAGTATTTCCGGATATTGTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172595.4-917s21c1
Sequence:GTACCGGGTGGATTATCATCGGCATTAACTCGAGTTAATGCCGATGATAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172595.4-470s21c1
Sequence:GTACCGGCCTCTTCAGAGGATGACTTAGCTCGAGCTAAGTCATCCTCTGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172595.1-1120s1c1
Sequence:CCGGCGCCATTGATATTTCCGTGATCTCGAGATCACGGAAATATCAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172595.1-179s1c1
Sequence:CCGGGCCCTGAATATGACTTGGTTTCTCGAGAAACCAAGTCATATTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172595.1-373s1c1
Sequence:CCGGCGCTACTACCAAGGATCTCAACTCGAGTTGAGATCCTTGGTAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172595.1-421s1c1
Sequence:CCGGTCTTCAGAGGATGACTTAGAACTCGAGTTCTAAGTCATCCTCTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172595.1-657s1c1
Sequence:CCGGGCTCATAAACTTGTTAGAAGACTCGAGTCTTCTAACAAGTTTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172595
ARL15 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 15
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172595.4-697s21c1
Sequence:GTACCGGAGCTTCTCCCAGCTCATAAACCTCGAGGTTTATGAGCTGGGAGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172595.4-396s21c1
Sequence:GTACCGGAGCTGACAATATCCGGAAATACTCGAGTATTTCCGGATATTGTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172595.4-917s21c1
Sequence:GTACCGGGTGGATTATCATCGGCATTAACTCGAGTTAATGCCGATGATAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172595.4-470s21c1
Sequence:GTACCGGCCTCTTCAGAGGATGACTTAGCTCGAGCTAAGTCATCCTCTGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172595.1-1120s1c1
Sequence:CCGGCGCCATTGATATTTCCGTGATCTCGAGATCACGGAAATATCAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172595.1-179s1c1
Sequence:CCGGGCCCTGAATATGACTTGGTTTCTCGAGAAACCAAGTCATATTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172595.1-373s1c1
Sequence:CCGGCGCTACTACCAAGGATCTCAACTCGAGTTGAGATCCTTGGTAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172595.1-421s1c1
Sequence:CCGGTCTTCAGAGGATGACTTAGAACTCGAGTTCTAAGTCATCCTCTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172595.1-657s1c1
Sequence:CCGGGCTCATAAACTTGTTAGAAGACTCGAGTCTTCTAACAAGTTTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172595
ARL15 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 15
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172595.4-697s21c1
Sequence:GTACCGGAGCTTCTCCCAGCTCATAAACCTCGAGGTTTATGAGCTGGGAGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172595.4-396s21c1
Sequence:GTACCGGAGCTGACAATATCCGGAAATACTCGAGTATTTCCGGATATTGTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172595.4-917s21c1
Sequence:GTACCGGGTGGATTATCATCGGCATTAACTCGAGTTAATGCCGATGATAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172595.4-470s21c1
Sequence:GTACCGGCCTCTTCAGAGGATGACTTAGCTCGAGCTAAGTCATCCTCTGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172595.1-1120s1c1
Sequence:CCGGCGCCATTGATATTTCCGTGATCTCGAGATCACGGAAATATCAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172595.1-179s1c1
Sequence:CCGGGCCCTGAATATGACTTGGTTTCTCGAGAAACCAAGTCATATTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172595.1-373s1c1
Sequence:CCGGCGCTACTACCAAGGATCTCAACTCGAGTTGAGATCCTTGGTAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172595.1-421s1c1
Sequence:CCGGTCTTCAGAGGATGACTTAGAACTCGAGTTCTAAGTCATCCTCTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172595.1-657s1c1
Sequence:CCGGGCTCATAAACTTGTTAGAAGACTCGAGTCTTCTAACAAGTTTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019087
ARL15 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 15
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019087.2-172s21c1
Sequence:GTACCGGACCACCTGCACGACCAGAATACTCGAGTATTCTGGTCGTGCAGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019087.2-349s21c1
Sequence:GTACCGGGGCTGATAACATCCGGAAATACTCGAGTATTTCCGGATGTTATCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019087.2-926s21c1
Sequence:GTACCGGTTCTCTGTTTACCACTAATTACTCGAGTAATTAGTGGTAAACAGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019087.2-1091s21c1
Sequence:GTACCGGGGTTTGGGAGTGGAGTATTATCTCGAGATAATACTCCACTCCCAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019087.2-686s21c1
Sequence:GTACCGGGACCATGAAGCTGTAAGAATGCTCGAGCATTCTTACAGCTTCATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019087.2-651s21c1
Sequence:GTACCGGGCTTCTCTCAGCTGATTAATTCTCGAGAATTAATCAGCTGAGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019087.1-542s1c1
Sequence:CCGGCGCTCAGTACAAGAGATCAAACTCGAGTTTGATCTCTTGTACTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019087.1-183s1c1
Sequence:CCGGGACCAGAATATGACCTGGTTTCTCGAGAAACCAGGTCATATTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019087.1-422s1c1
Sequence:CCGGGCCTCTTCAGAGGATGATTTACTCGAGTAAATCATCCTCTGAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019087.1-361s1c1
Sequence:CCGGCCGGAAATACTGGAGCCGCTACTCGAGTAGCGGCTCCAGTATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019087.1-478s1c1
Sequence:CCGGGCATCCACAGTTATGCACTTTCTCGAGAAAGTGCATAACTGTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019087
ARL15 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 15
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019087.2-172s21c1
Sequence:GTACCGGACCACCTGCACGACCAGAATACTCGAGTATTCTGGTCGTGCAGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019087.2-349s21c1
Sequence:GTACCGGGGCTGATAACATCCGGAAATACTCGAGTATTTCCGGATGTTATCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019087.2-926s21c1
Sequence:GTACCGGTTCTCTGTTTACCACTAATTACTCGAGTAATTAGTGGTAAACAGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019087.2-1091s21c1
Sequence:GTACCGGGGTTTGGGAGTGGAGTATTATCTCGAGATAATACTCCACTCCCAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019087.2-686s21c1
Sequence:GTACCGGGACCATGAAGCTGTAAGAATGCTCGAGCATTCTTACAGCTTCATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019087.2-651s21c1
Sequence:GTACCGGGCTTCTCTCAGCTGATTAATTCTCGAGAATTAATCAGCTGAGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019087.1-542s1c1
Sequence:CCGGCGCTCAGTACAAGAGATCAAACTCGAGTTTGATCTCTTGTACTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019087.1-183s1c1
Sequence:CCGGGACCAGAATATGACCTGGTTTCTCGAGAAACCAGGTCATATTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019087.1-422s1c1
Sequence:CCGGGCCTCTTCAGAGGATGATTTACTCGAGTAAATCATCCTCTGAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019087.1-361s1c1
Sequence:CCGGCCGGAAATACTGGAGCCGCTACTCGAGTAGCGGCTCCAGTATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019087.1-478s1c1
Sequence:CCGGGCATCCACAGTTATGCACTTTCTCGAGAAAGTGCATAACTGTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019087
ARL15 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 15
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019087.2-172s21c1
Sequence:GTACCGGACCACCTGCACGACCAGAATACTCGAGTATTCTGGTCGTGCAGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019087.2-349s21c1
Sequence:GTACCGGGGCTGATAACATCCGGAAATACTCGAGTATTTCCGGATGTTATCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019087.2-926s21c1
Sequence:GTACCGGTTCTCTGTTTACCACTAATTACTCGAGTAATTAGTGGTAAACAGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019087.2-1091s21c1
Sequence:GTACCGGGGTTTGGGAGTGGAGTATTATCTCGAGATAATACTCCACTCCCAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019087.2-686s21c1
Sequence:GTACCGGGACCATGAAGCTGTAAGAATGCTCGAGCATTCTTACAGCTTCATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019087.2-651s21c1
Sequence:GTACCGGGCTTCTCTCAGCTGATTAATTCTCGAGAATTAATCAGCTGAGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019087.1-542s1c1
Sequence:CCGGCGCTCAGTACAAGAGATCAAACTCGAGTTTGATCTCTTGTACTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019087.1-183s1c1
Sequence:CCGGGACCAGAATATGACCTGGTTTCTCGAGAAACCAGGTCATATTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019087.1-422s1c1
Sequence:CCGGGCCTCTTCAGAGGATGATTTACTCGAGTAAATCATCCTCTGAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019087.1-361s1c1
Sequence:CCGGCCGGAAATACTGGAGCCGCTACTCGAGTAGCGGCTCCAGTATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019087.1-478s1c1
Sequence:CCGGGCATCCACAGTTATGCACTTTCTCGAGAAAGTGCATAACTGTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks