EMAIL THIS PAGE TO A FRIEND

ARL16

ADP-ribosylation factor-like 16

41 Gene Product Result for
UniProtKB ID: Q0P5N6
Gene ID:
Mouse(70317) ADP-ribosylation factor-like 16
Rat(688311) ADP-ribosylation factor-like 16
Zebrafish(100037345) ADP-ribosylation factor-like 16
cow(518665) ADP-ribosylation factor-like 16
domestic cat(101098909) ADP-ribosylation factor-like 16
dog(483366) ADP-ribosylation factor-like 16
chicken(768991) ADP-ribosylation factor-like 16
sheep(101116745) ADP-ribosylation factor-like 16
naked mole-rat(101707660) ADP-ribosylation factor-like 16
domestic guinea pig(100712986) ADP-ribosylation factor-like 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040025 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040025 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040025 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_197995 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_197995 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_197995 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU080641 MISSION® esiRNA esiRNA targeting mouse Arl16 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040025 Rosetta Predictions human pricing
XM_001081794 Rosetta Predictions rat pricing
NM_197995 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231211 predicted 513
2 SASI_Hs01_00231212 predicted 571
3 SASI_Hs01_00231213 predicted 230
4 SASI_Hs01_00231214 predicted 617
5 SASI_Hs01_00231215 predicted 547
6 SASI_Hs01_00231216 predicted 294
7 SASI_Hs01_00231217 predicted 308
8 SASI_Hs01_00231218 predicted 484
9 SASI_Hs01_00231219 predicted 439
10 SASI_Hs01_00231220 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081794 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00373512 predicted 389
2 SASI_Rn02_00373513 predicted 488
3 SASI_Rn02_00373514 predicted 497
4 SASI_Rn02_00373515 predicted 206
5 SASI_Rn02_00373516 predicted 583
6 SASI_Rn02_00373517 predicted 290
7 SASI_Rn02_00373518 predicted 232
8 SASI_Rn02_00373519 predicted 367
9 SASI_Rn02_00373520 predicted 291
10 SASI_Rn02_00373521 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197995 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174130 predicted 656
2 SASI_Mm01_00174131 predicted 582
3 SASI_Mm01_00174133 predicted 684
4 SASI_Mm01_00174134 predicted 546
5 SASI_Mm01_00174135 predicted 307
6 SASI_Mm01_00174137 predicted 780
7 SASI_Mm01_00174138 predicted 815
8 SASI_Mm01_00174139 predicted 831
9 SASI_Mm02_00350687 predicted 530
10 SASI_Mm02_00350688 predicted 856
11 SASI_Mm01_00174132 predicted 838
12 SASI_Mm01_00174136 predicted 503
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040025
VALIDATED
ARL16 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 16
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001040025.1-544s21c1
Sequence:CCGGACGGAGGAGATGAAGTCATTACTCGAGTAATGACTTCATCTCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253730    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001040025.1-746s21c1
Sequence:CCGGGTATGGCTTTGCTGCCAATAGCTCGAGCTATTGGCAGCAAAGCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001040025.1-600s21c1
Sequence:CCGGGAACATCACCACGGCAGAAATCTCGAGATTTCTGCCGTGGTGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001040025.1-499s21c1
Sequence:CCGGGTGCTGATACTCTTCAATAAACTCGAGTTTATTGAAGAGTATCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001040025.1-443s21c1
Sequence:CCGGCATCCTGTGTGCAGCTCTTAGCTCGAGCTAAGAGCTGCACACAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040025
VALIDATED
ARL16 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 16
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001040025.1-544s21c1
Sequence:CCGGACGGAGGAGATGAAGTCATTACTCGAGTAATGACTTCATCTCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253730    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001040025.1-746s21c1
Sequence:CCGGGTATGGCTTTGCTGCCAATAGCTCGAGCTATTGGCAGCAAAGCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001040025.1-600s21c1
Sequence:CCGGGAACATCACCACGGCAGAAATCTCGAGATTTCTGCCGTGGTGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001040025.1-499s21c1
Sequence:CCGGGTGCTGATACTCTTCAATAAACTCGAGTTTATTGAAGAGTATCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001040025.1-443s21c1
Sequence:CCGGCATCCTGTGTGCAGCTCTTAGCTCGAGCTAAGAGCTGCACACAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040025
VALIDATED
ARL16 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 16
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001040025.1-544s21c1
Sequence:CCGGACGGAGGAGATGAAGTCATTACTCGAGTAATGACTTCATCTCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253730    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001040025.1-746s21c1
Sequence:CCGGGTATGGCTTTGCTGCCAATAGCTCGAGCTATTGGCAGCAAAGCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001040025.1-600s21c1
Sequence:CCGGGAACATCACCACGGCAGAAATCTCGAGATTTCTGCCGTGGTGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001040025.1-499s21c1
Sequence:CCGGGTGCTGATACTCTTCAATAAACTCGAGTTTATTGAAGAGTATCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001040025.1-443s21c1
Sequence:CCGGCATCCTGTGTGCAGCTCTTAGCTCGAGCTAAGAGCTGCACACAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_197995
VALIDATED
ARL16 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_197995.2-608s21c1
Sequence:CCGGACATCACCGCAGTAGAAATAACTCGAGTTATTTCTACTGCGGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_197995.2-550s21c1
Sequence:CCGGATGGAGGAAATGAAGTCATTGCTCGAGCAATGACTTCATTTCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_197995.2-505s21c1
Sequence:CCGGGTCCTCATACTCTTCAATAAACTCGAGTTTATTGAAGAGTATGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_197995.2-1615s21c1
Sequence:CCGGTGCAGATACAGCACTCATATACTCGAGTATATGAGTGCTGTATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_197995.2-642s21c1
Sequence:CCGGCACTGGCTTGGCAACAGTATTCTCGAGAATACTGTTGCCAAGCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_197995
VALIDATED
ARL16 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_197995.2-608s21c1
Sequence:CCGGACATCACCGCAGTAGAAATAACTCGAGTTATTTCTACTGCGGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_197995.2-550s21c1
Sequence:CCGGATGGAGGAAATGAAGTCATTGCTCGAGCAATGACTTCATTTCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_197995.2-505s21c1
Sequence:CCGGGTCCTCATACTCTTCAATAAACTCGAGTTTATTGAAGAGTATGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_197995.2-1615s21c1
Sequence:CCGGTGCAGATACAGCACTCATATACTCGAGTATATGAGTGCTGTATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_197995.2-642s21c1
Sequence:CCGGCACTGGCTTGGCAACAGTATTCTCGAGAATACTGTTGCCAAGCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_197995
VALIDATED
ARL16 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_197995.2-608s21c1
Sequence:CCGGACATCACCGCAGTAGAAATAACTCGAGTTATTTCTACTGCGGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_197995.2-550s21c1
Sequence:CCGGATGGAGGAAATGAAGTCATTGCTCGAGCAATGACTTCATTTCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_197995.2-505s21c1
Sequence:CCGGGTCCTCATACTCTTCAATAAACTCGAGTTTATTGAAGAGTATGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_197995.2-1615s21c1
Sequence:CCGGTGCAGATACAGCACTCATATACTCGAGTATATGAGTGCTGTATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_197995.2-642s21c1
Sequence:CCGGCACTGGCTTGGCAACAGTATTCTCGAGAATACTGTTGCCAAGCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks