EMAIL THIS PAGE TO A FRIEND

ARL17A

ADP-ribosylation factor-like 17A

Synonyms: ARF1P2 ARL17P1
Species: Human ARL17A(51326)
Gene ID:
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016632 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016632 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016632 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113738 Rosetta Predictions human pricing
NM_016632 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326111 predicted 468
2 SASI_Hs02_00326112 predicted 533
3 SASI_Hs02_00326113 predicted 648
4 SASI_Hs02_00326114 predicted 333
5 SASI_Hs02_00326115 predicted 328
6 SASI_Hs02_00326116 predicted 286
7 SASI_Hs02_00326117 predicted 191
8 SASI_Hs02_00326118 predicted 457
9 SASI_Hs02_00326119 predicted 225
10 SASI_Hs02_00326120 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349796 predicted 579
2 SASI_Hs01_00167051 predicted 580
3 SASI_Hs01_00167054 predicted 544
4 SASI_Hs01_00167056 predicted 584
5 SASI_Hs01_00167057 predicted 622
6 SASI_Hs02_00349797 predicted 589
7 SASI_Hs02_00349798 predicted 616
8 SASI_Hs02_00349799 predicted 544
9 SASI_Hs02_00349800 predicted 552
10 SASI_Hs02_00349801 predicted 467
11 SASI_Hs01_00167048 predicted 417
12 SASI_Hs01_00167049 predicted 411
13 SASI_Hs01_00167050 predicted 423
14 SASI_Hs01_00167052 predicted 343
15 SASI_Hs01_00167053 predicted 461
16 SASI_Hs01_00167055 predicted 356
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016632
ARL17A MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 17A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016632.1-156s1c1
Sequence:CCGGGAGTTTGGATACAGCTGGAAACTCGAGTTTCCAGCTGTATCCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016632.1-447s1c1
Sequence:CCGGCCCATCTCTTGGACAGATGATCTCGAGATCATCTGTCCAAGAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016632.1-286s1c1
Sequence:CCGGGATGTTGGCAGCCACTTCAAACTCGAGTTTGAAGTGGCTGCCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016632.1-230s1c1
Sequence:CCGGCAGTAGGTTTCTGTGTGGAGACTCGAGTCTCCACACAGAAACCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016632.1-541s1c1
Sequence:CCGGGCCAGGTAACACCAAAGCTTTCTCGAGAAAGCTTTGGTGTTACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016632
ARL17A MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 17A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016632.1-156s1c1
Sequence:CCGGGAGTTTGGATACAGCTGGAAACTCGAGTTTCCAGCTGTATCCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016632.1-447s1c1
Sequence:CCGGCCCATCTCTTGGACAGATGATCTCGAGATCATCTGTCCAAGAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016632.1-286s1c1
Sequence:CCGGGATGTTGGCAGCCACTTCAAACTCGAGTTTGAAGTGGCTGCCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016632.1-230s1c1
Sequence:CCGGCAGTAGGTTTCTGTGTGGAGACTCGAGTCTCCACACAGAAACCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016632.1-541s1c1
Sequence:CCGGGCCAGGTAACACCAAAGCTTTCTCGAGAAAGCTTTGGTGTTACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016632
ARL17A MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 17A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016632.1-156s1c1
Sequence:CCGGGAGTTTGGATACAGCTGGAAACTCGAGTTTCCAGCTGTATCCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016632.1-447s1c1
Sequence:CCGGCCCATCTCTTGGACAGATGATCTCGAGATCATCTGTCCAAGAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016632.1-286s1c1
Sequence:CCGGGATGTTGGCAGCCACTTCAAACTCGAGTTTGAAGTGGCTGCCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016632.1-230s1c1
Sequence:CCGGCAGTAGGTTTCTGTGTGGAGACTCGAGTCTCCACACAGAAACCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016632.1-541s1c1
Sequence:CCGGGCCAGGTAACACCAAAGCTTTCTCGAGAAAGCTTTGGTGTTACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks