EMAIL THIS PAGE TO A FRIEND

ARL1

ADP-ribosylation factor-like 1

55 Gene Product Result for
Synonyms: ARFL1
UniProtKB ID: P40616, P80417, Q53XB1
Gene ID:
Human(400) Summary: The protein encoded by this gene belongs to the ARL (ADP-ribosylation factor-like) family of proteins, which are structurally related to ADP-ribosylation factors (ARFs). ARFs, described as activators of cholera toxin (CT) ADP-ribosyltransferase activity, regulate intracellular vesicular membrane trafficking, and stimulate a phospholipase D (PLD) isoform. Although, ARL proteins were initially thought not to activate CT or PLD, later work showed that they are weak stimulators of PLD and CT in a phospholipid dependent manner. [provided by RefSeq, Jul 2008]
Mouse(104303) ADP-ribosylation factor-like 1
Rat(64187) ADP-ribosylation factor-like 1
Zebrafish(436746) ADP-ribosylation factor-like 1
dog(612931) ADP-ribosylation factor-like 1
cow(517345) ADP-ribosylation factor-like 1
domestic cat(101098970) ADP-ribosylation factor-like 1
Thale Cress(839024) ARG1-like 1
chicken(417934) ADP-ribosylation factor-like 1
domestic guinea pig(100725141) ADP-ribosylation factor-like 1
naked mole-rat(101712001) ADP-ribosylation factor-like 1
sheep(100145883) ADP-ribosylation factor-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001177 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001177 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001177 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025859 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025859 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025859 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001177 Rosetta Predictions human pricing
NM_022385 Rosetta Predictions rat pricing
NM_025859 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216833 predicted 649
2 SASI_Hs01_00216834 predicted 402
3 SASI_Hs01_00216835 predicted 423
4 SASI_Hs01_00216836 predicted 663
5 SASI_Hs01_00216837 predicted 766
6 SASI_Hs01_00216839 predicted 282
7 SASI_Hs01_00216840 predicted 372
8 SASI_Hs01_00216841 predicted 433
9 SASI_Hs01_00216842 predicted 639
10 SASI_Hs02_00331305 predicted 265
11 SASI_Hs01_00216838 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022385 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263148 predicted 624
2 SASI_Rn02_00263149 predicted 340
3 SASI_Rn02_00263150 predicted 377
4 SASI_Rn01_00039373 predicted 387
5 SASI_Rn02_00263151 predicted 195
6 SASI_Rn02_00263152 predicted 622
7 SASI_Rn01_00039374 predicted 345
8 SASI_Rn02_00263153 predicted 220
9 SASI_Rn01_00039375 predicted 592
10 SASI_Rn01_00039376 predicted 371
11 SASI_Rn01_00039367 predicted 849
12 SASI_Rn01_00039368 predicted 284
13 SASI_Rn01_00039369 predicted 404
14 SASI_Rn01_00039370 predicted 909
15 SASI_Rn01_00039371 predicted 991
16 SASI_Rn01_00039372 predicted 896
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025859 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053570 predicted 545
2 SASI_Mm01_00053571 predicted 399
3 SASI_Mm01_00053572 predicted 262
4 SASI_Mm01_00053573 predicted 433
5 SASI_Mm02_00329164 predicted 417
6 SASI_Mm01_00053575 predicted 417
7 SASI_Mm01_00053576 predicted 440
8 SASI_Mm01_00053577 predicted 273
9 SASI_Mm01_00053579 predicted 413
10 SASI_Mm02_00329165 predicted 257
11 SASI_Mm01_00053574 predicted 674
12 SASI_Mm01_00053578 predicted 660
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001177
VALIDATED
ARL1 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001177.3-436s21c1
Sequence:GTACCGGACCGAGACCGAATTGGCATTTCTCGAGAAATGCCAATTCGGTCTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001177.3-190s21c1
Sequence:CCGGGAACTCGGGAAATGAGAATTTCTCGAGAAATTCTCATTTCCCGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001177.3-374s21c1
Sequence:CCGGGCCATACTGGAGATGTTACTACTCGAGTAGTAACATCTCCAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001177.3-643s21c1
Sequence:CCGGGCCTTGATGAGGCAATGGAATCTCGAGATTCCATTGCCTCATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001177.3-397s21c1
Sequence:CCGGCAAACACAGATGCAGTCATTTCTCGAGAAATGACTGCATCTGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379711    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001177.3-806s21c1
Sequence:GTACCGGATACTGACTGACTGCAATATTCTCGAGAATATTGCAGTCAGTCAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001177.3-850s21c1
Sequence:GTACCGGATTTAGTTGGAGGGATAATTTCTCGAGAAATTATCCCTCCAACTAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001177.3-1030s21c1
Sequence:GTACCGGTGCAGCTTGTTTGTATAAATACTCGAGTATTTATACAAACAAGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001177.3-397s1c1
Sequence:CCGGCAAACACAGATGCAGTCATTTCTCGAGAAATGACTGCATCTGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001177.3-643s1c1
Sequence:CCGGGCCTTGATGAGGCAATGGAATCTCGAGATTCCATTGCCTCATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001177.3-276s1c1
Sequence:CCGGGTTACTACTATACCTACCATTCTCGAGAATGGTAGGTATAGTAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001177.3-190s1c1
Sequence:CCGGGAACTCGGGAAATGAGAATTTCTCGAGAAATTCTCATTTCCCGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001177.3-374s1c1
Sequence:CCGGGCCATACTGGAGATGTTACTACTCGAGTAGTAACATCTCCAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001177
VALIDATED
ARL1 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001177.3-436s21c1
Sequence:GTACCGGACCGAGACCGAATTGGCATTTCTCGAGAAATGCCAATTCGGTCTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001177.3-190s21c1
Sequence:CCGGGAACTCGGGAAATGAGAATTTCTCGAGAAATTCTCATTTCCCGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001177.3-374s21c1
Sequence:CCGGGCCATACTGGAGATGTTACTACTCGAGTAGTAACATCTCCAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001177.3-643s21c1
Sequence:CCGGGCCTTGATGAGGCAATGGAATCTCGAGATTCCATTGCCTCATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001177.3-397s21c1
Sequence:CCGGCAAACACAGATGCAGTCATTTCTCGAGAAATGACTGCATCTGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379711    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001177.3-806s21c1
Sequence:GTACCGGATACTGACTGACTGCAATATTCTCGAGAATATTGCAGTCAGTCAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001177.3-850s21c1
Sequence:GTACCGGATTTAGTTGGAGGGATAATTTCTCGAGAAATTATCCCTCCAACTAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001177.3-1030s21c1
Sequence:GTACCGGTGCAGCTTGTTTGTATAAATACTCGAGTATTTATACAAACAAGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001177.3-397s1c1
Sequence:CCGGCAAACACAGATGCAGTCATTTCTCGAGAAATGACTGCATCTGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001177.3-643s1c1
Sequence:CCGGGCCTTGATGAGGCAATGGAATCTCGAGATTCCATTGCCTCATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001177.3-276s1c1
Sequence:CCGGGTTACTACTATACCTACCATTCTCGAGAATGGTAGGTATAGTAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001177.3-190s1c1
Sequence:CCGGGAACTCGGGAAATGAGAATTTCTCGAGAAATTCTCATTTCCCGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001177.3-374s1c1
Sequence:CCGGGCCATACTGGAGATGTTACTACTCGAGTAGTAACATCTCCAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001177
VALIDATED
ARL1 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001177.3-436s21c1
Sequence:GTACCGGACCGAGACCGAATTGGCATTTCTCGAGAAATGCCAATTCGGTCTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001177.3-190s21c1
Sequence:CCGGGAACTCGGGAAATGAGAATTTCTCGAGAAATTCTCATTTCCCGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001177.3-374s21c1
Sequence:CCGGGCCATACTGGAGATGTTACTACTCGAGTAGTAACATCTCCAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001177.3-643s21c1
Sequence:CCGGGCCTTGATGAGGCAATGGAATCTCGAGATTCCATTGCCTCATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001177.3-397s21c1
Sequence:CCGGCAAACACAGATGCAGTCATTTCTCGAGAAATGACTGCATCTGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379711    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001177.3-806s21c1
Sequence:GTACCGGATACTGACTGACTGCAATATTCTCGAGAATATTGCAGTCAGTCAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001177.3-850s21c1
Sequence:GTACCGGATTTAGTTGGAGGGATAATTTCTCGAGAAATTATCCCTCCAACTAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001177.3-1030s21c1
Sequence:GTACCGGTGCAGCTTGTTTGTATAAATACTCGAGTATTTATACAAACAAGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001177.3-397s1c1
Sequence:CCGGCAAACACAGATGCAGTCATTTCTCGAGAAATGACTGCATCTGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001177.3-643s1c1
Sequence:CCGGGCCTTGATGAGGCAATGGAATCTCGAGATTCCATTGCCTCATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001177.3-276s1c1
Sequence:CCGGGTTACTACTATACCTACCATTCTCGAGAATGGTAGGTATAGTAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001177.3-190s1c1
Sequence:CCGGGAACTCGGGAAATGAGAATTTCTCGAGAAATTCTCATTTCCCGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001177.3-374s1c1
Sequence:CCGGGCCATACTGGAGATGTTACTACTCGAGTAGTAACATCTCCAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025859
VALIDATED
ARL1 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025859.3-652s21c1
Sequence:CCGGGCAATGGAATGGTTAGTTGAACTCGAGTTCAACTAACCATTCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025859.3-372s21c1
Sequence:CCGGGCCATACTGGAGATGTTATTACTCGAGTAATAACATCTCCAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025859.3-596s21c1
Sequence:CCGGACCGGAAGTGGCAGATCTTTACTCGAGTAAAGATCTGCCACTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025859.3-551s21c1
Sequence:CCGGCACCCTCAGAAATGGCAAATGCTCGAGCATTTGCCATTTCTGAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025859.3-434s21c1
Sequence:CCGGACCGAGATCGAATTGGCATTTCTCGAGAAATGCCAATTCGATCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025859.1-881s1c1
Sequence:CCGGGCTTGATTGAATCACCCAAATCTCGAGATTTGGGTGATTCAATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025859.1-672s1c1
Sequence:CCGGGCAATGGAATGGTTAGTTGAACTCGAGTTCAACTAACCATTCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025859.1-540s1c1
Sequence:CCGGGCAAATAAGCAGGACATGGAACTCGAGTTCCATGTCCTGCTTATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025859.1-392s1c1
Sequence:CCGGGCCATACTGGAGATGTTATTACTCGAGTAATAACATCTCCAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025859.1-294s1c1
Sequence:CCGGGTTACTACTATTCCCACTATTCTCGAGAATAGTGGGAATAGTAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025859
VALIDATED
ARL1 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025859.3-652s21c1
Sequence:CCGGGCAATGGAATGGTTAGTTGAACTCGAGTTCAACTAACCATTCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025859.3-372s21c1
Sequence:CCGGGCCATACTGGAGATGTTATTACTCGAGTAATAACATCTCCAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025859.3-596s21c1
Sequence:CCGGACCGGAAGTGGCAGATCTTTACTCGAGTAAAGATCTGCCACTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025859.3-551s21c1
Sequence:CCGGCACCCTCAGAAATGGCAAATGCTCGAGCATTTGCCATTTCTGAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025859.3-434s21c1
Sequence:CCGGACCGAGATCGAATTGGCATTTCTCGAGAAATGCCAATTCGATCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025859.1-881s1c1
Sequence:CCGGGCTTGATTGAATCACCCAAATCTCGAGATTTGGGTGATTCAATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025859.1-672s1c1
Sequence:CCGGGCAATGGAATGGTTAGTTGAACTCGAGTTCAACTAACCATTCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025859.1-540s1c1
Sequence:CCGGGCAAATAAGCAGGACATGGAACTCGAGTTCCATGTCCTGCTTATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025859.1-392s1c1
Sequence:CCGGGCCATACTGGAGATGTTATTACTCGAGTAATAACATCTCCAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025859.1-294s1c1
Sequence:CCGGGTTACTACTATTCCCACTATTCTCGAGAATAGTGGGAATAGTAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025859
VALIDATED
ARL1 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025859.3-652s21c1
Sequence:CCGGGCAATGGAATGGTTAGTTGAACTCGAGTTCAACTAACCATTCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025859.3-372s21c1
Sequence:CCGGGCCATACTGGAGATGTTATTACTCGAGTAATAACATCTCCAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025859.3-596s21c1
Sequence:CCGGACCGGAAGTGGCAGATCTTTACTCGAGTAAAGATCTGCCACTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025859.3-551s21c1
Sequence:CCGGCACCCTCAGAAATGGCAAATGCTCGAGCATTTGCCATTTCTGAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025859.3-434s21c1
Sequence:CCGGACCGAGATCGAATTGGCATTTCTCGAGAAATGCCAATTCGATCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025859.1-881s1c1
Sequence:CCGGGCTTGATTGAATCACCCAAATCTCGAGATTTGGGTGATTCAATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025859.1-672s1c1
Sequence:CCGGGCAATGGAATGGTTAGTTGAACTCGAGTTCAACTAACCATTCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025859.1-540s1c1
Sequence:CCGGGCAAATAAGCAGGACATGGAACTCGAGTTCCATGTCCTGCTTATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025859.1-392s1c1
Sequence:CCGGGCCATACTGGAGATGTTATTACTCGAGTAATAACATCTCCAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025859.1-294s1c1
Sequence:CCGGGTTACTACTATTCCCACTATTCTCGAGAATAGTGGGAATAGTAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks