EMAIL THIS PAGE TO A FRIEND

ARL2

ADP-ribosylation factor-like 2

69 Gene Product Result for
Synonyms: ARFL2
UniProtKB ID: P36404, G3V184, Q9BUK8
Gene ID:
Human(402) Summary: This gene encodes a small GTP-binding protein of the RAS superfamily which functions as an ADP-ribosylation factor (ARF). The encoded protein is one of a functionally distinct group of ARF-like genes. [provided by RefSeq, Jul 2008]
Mouse(56327) ADP-ribosylation factor-like 2
Rat(65142) ADP-ribosylation factor-like 2
Zebrafish(449774) ADP-ribosylation factor-like 2
chicken(769546) ADP-ribosylation factor-like 2
Thale Cress(842292) ARG1-like 2
cow(511349) ADP-ribosylation factor-like 2
domestic cat(101081671) ADP-ribosylation factor-like 2
dog(483753) ADP-ribosylation factor-like 2
domestic guinea pig(100724090) ADP-ribosylation factor-like 2
naked mole-rat(101703989) ADP-ribosylation factor-like 2
sheep(100302310) ADP-ribosylation factor-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001667 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001667 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001667 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019722 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019722 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019722 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU029941 MISSION® esiRNA esiRNA targeting mouse Arl2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001667 Rosetta Predictions human pricing
NM_031711 Rosetta Predictions rat pricing
NM_019722 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011056 predicted 340
2 SASI_Hs01_00011060 predicted 281
3 SASI_Hs01_00011061 predicted 346
4 SASI_Hs01_00011062 predicted 434
5 SASI_Hs02_00332297 predicted 494
6 SASI_Hs01_00011063 predicted 441
7 SASI_Hs02_00332298 predicted 433
8 SASI_Hs02_00332299 predicted 349
9 SASI_Hs02_00332300 predicted 343
10 SASI_Hs01_00011057 predicted 309
11 SASI_Hs01_00011058 predicted 233
12 SASI_Hs01_00011059 predicted 234
13 SASI_Hs01_00011064 predicted 233
14 SASI_Hs01_00011065 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031711 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265074 predicted 627
2 SASI_Rn01_00075775 predicted 428
3 SASI_Rn01_00075776 predicted 591
4 SASI_Rn01_00075777 predicted 204
5 SASI_Rn01_00075778 predicted 420
6 SASI_Rn01_00075779 predicted 565
7 SASI_Rn01_00075780 predicted 418
8 SASI_Rn01_00075781 predicted 280
9 SASI_Rn01_00075782 predicted 578
10 SASI_Rn01_00075783 predicted 229
11 SASI_Rn01_00075784 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019722 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101076 predicted 252
2 SASI_Mm01_00101077 predicted 427
3 SASI_Mm01_00101078 predicted 434
4 SASI_Mm01_00101079 predicted 571
5 SASI_Mm01_00101080 predicted 206
6 SASI_Mm01_00101081 predicted 423
7 SASI_Mm01_00101082 predicted 584
8 SASI_Mm01_00101083 predicted 211
9 SASI_Mm01_00101084 predicted 250
10 SASI_Mm01_00101085 predicted 382
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001667
VALIDATED
ARL2 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001667.1-368s1c1
Sequence:CCGGCCTCCTCATCTTTGCTAATAACTCGAGTTATTAGCAAAGATGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001667.1-531s1c1
Sequence:CCGGGATGACATTTCCAGCCGCATTCTCGAGAATGCGGCTGGAAATGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001667.1-182s1c1
Sequence:CCGGCCGAGGATTCAAGCTGAACATCTCGAGATGTTCAGCTTGAATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001667.1-245s1c1
Sequence:CCGGGAACTACTTTGAGAGCACCGACTCGAGTCGGTGCTCTCAAAGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001667.1-102s1c1
Sequence:CCGGACCATCCTGAAGAAGTTCAATCTCGAGATTGAACTTCTTCAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001667.2-443s21c1
Sequence:GTACCGGGGAGCAACCCTCCTCATCTTTCTCGAGAAAGATGAGGAGGGTTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001667.2-185s21c1
Sequence:CCGGACCATCCTGAAGAAGTTCAATCTCGAGATTGAACTTCTTCAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001667.2-451s21c1
Sequence:CCGGCCTCCTCATCTTTGCTAATAACTCGAGTTATTAGCAAAGATGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001667.2-265s21c1
Sequence:CCGGCCGAGGATTCAAGCTGAACATCTCGAGATGTTCAGCTTGAATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001667.2-684s21c1
Sequence:CCGGTCCCTCAACCTTCACCAAACACTCGAGTGTTTGGTGAAGGTTGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001667.2-234s21c1
Sequence:CCGGCGCTGGGCTTCAACATCAAGACTCGAGTCTTGATGTTGAAGCCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001667.2-615s21c1
Sequence:GTACCGGATGACATTTCCAGCCGCATTTCTCGAGAAATGCGGCTGGAAATGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001667
VALIDATED
ARL2 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001667.1-368s1c1
Sequence:CCGGCCTCCTCATCTTTGCTAATAACTCGAGTTATTAGCAAAGATGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001667.1-531s1c1
Sequence:CCGGGATGACATTTCCAGCCGCATTCTCGAGAATGCGGCTGGAAATGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001667.1-182s1c1
Sequence:CCGGCCGAGGATTCAAGCTGAACATCTCGAGATGTTCAGCTTGAATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001667.1-245s1c1
Sequence:CCGGGAACTACTTTGAGAGCACCGACTCGAGTCGGTGCTCTCAAAGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001667.1-102s1c1
Sequence:CCGGACCATCCTGAAGAAGTTCAATCTCGAGATTGAACTTCTTCAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001667.2-443s21c1
Sequence:GTACCGGGGAGCAACCCTCCTCATCTTTCTCGAGAAAGATGAGGAGGGTTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001667.2-185s21c1
Sequence:CCGGACCATCCTGAAGAAGTTCAATCTCGAGATTGAACTTCTTCAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001667.2-451s21c1
Sequence:CCGGCCTCCTCATCTTTGCTAATAACTCGAGTTATTAGCAAAGATGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001667.2-265s21c1
Sequence:CCGGCCGAGGATTCAAGCTGAACATCTCGAGATGTTCAGCTTGAATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001667.2-684s21c1
Sequence:CCGGTCCCTCAACCTTCACCAAACACTCGAGTGTTTGGTGAAGGTTGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001667.2-234s21c1
Sequence:CCGGCGCTGGGCTTCAACATCAAGACTCGAGTCTTGATGTTGAAGCCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001667.2-615s21c1
Sequence:GTACCGGATGACATTTCCAGCCGCATTTCTCGAGAAATGCGGCTGGAAATGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001667
VALIDATED
ARL2 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001667.1-368s1c1
Sequence:CCGGCCTCCTCATCTTTGCTAATAACTCGAGTTATTAGCAAAGATGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001667.1-531s1c1
Sequence:CCGGGATGACATTTCCAGCCGCATTCTCGAGAATGCGGCTGGAAATGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001667.1-182s1c1
Sequence:CCGGCCGAGGATTCAAGCTGAACATCTCGAGATGTTCAGCTTGAATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001667.1-245s1c1
Sequence:CCGGGAACTACTTTGAGAGCACCGACTCGAGTCGGTGCTCTCAAAGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001667.1-102s1c1
Sequence:CCGGACCATCCTGAAGAAGTTCAATCTCGAGATTGAACTTCTTCAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001667.2-443s21c1
Sequence:GTACCGGGGAGCAACCCTCCTCATCTTTCTCGAGAAAGATGAGGAGGGTTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001667.2-185s21c1
Sequence:CCGGACCATCCTGAAGAAGTTCAATCTCGAGATTGAACTTCTTCAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001667.2-451s21c1
Sequence:CCGGCCTCCTCATCTTTGCTAATAACTCGAGTTATTAGCAAAGATGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001667.2-265s21c1
Sequence:CCGGCCGAGGATTCAAGCTGAACATCTCGAGATGTTCAGCTTGAATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001667.2-684s21c1
Sequence:CCGGTCCCTCAACCTTCACCAAACACTCGAGTGTTTGGTGAAGGTTGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001667.2-234s21c1
Sequence:CCGGCGCTGGGCTTCAACATCAAGACTCGAGTCTTGATGTTGAAGCCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001667.2-615s21c1
Sequence:GTACCGGATGACATTTCCAGCCGCATTTCTCGAGAAATGCGGCTGGAAATGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019722
ARL2 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019722.3-691s1c1
Sequence:CCGGCTGCTGCTATTACTGCCCATTCTCGAGAATGGGCAGTAATAGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019722.3-133s1c1
Sequence:CCGGCTCAAGAAGTTCAATGGAGAACTCGAGTTCTCCATTGAACTTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019722.3-558s1c1
Sequence:CCGGTGACATTTCCAGTCGTGTCTTCTCGAGAAGACACGACTGGAAATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019722.3-258s1c1
Sequence:CCGGCTCCTACTGGAGGAACTACTTCTCGAGAAGTAGTTCCTCCAGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019722.3-207s1c1
Sequence:CCGGCCGCGGATTCAAGCTGAACATCTCGAGATGTTCAGCTTGAATCCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019722
ARL2 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019722.3-691s1c1
Sequence:CCGGCTGCTGCTATTACTGCCCATTCTCGAGAATGGGCAGTAATAGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019722.3-133s1c1
Sequence:CCGGCTCAAGAAGTTCAATGGAGAACTCGAGTTCTCCATTGAACTTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019722.3-558s1c1
Sequence:CCGGTGACATTTCCAGTCGTGTCTTCTCGAGAAGACACGACTGGAAATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019722.3-258s1c1
Sequence:CCGGCTCCTACTGGAGGAACTACTTCTCGAGAAGTAGTTCCTCCAGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019722.3-207s1c1
Sequence:CCGGCCGCGGATTCAAGCTGAACATCTCGAGATGTTCAGCTTGAATCCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019722
ARL2 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019722.3-691s1c1
Sequence:CCGGCTGCTGCTATTACTGCCCATTCTCGAGAATGGGCAGTAATAGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019722.3-133s1c1
Sequence:CCGGCTCAAGAAGTTCAATGGAGAACTCGAGTTCTCCATTGAACTTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019722.3-558s1c1
Sequence:CCGGTGACATTTCCAGTCGTGTCTTCTCGAGAAGACACGACTGGAAATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019722.3-258s1c1
Sequence:CCGGCTCCTACTGGAGGAACTACTTCTCGAGAAGTAGTTCCTCCAGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019722.3-207s1c1
Sequence:CCGGCCGCGGATTCAAGCTGAACATCTCGAGATGTTCAGCTTGAATCCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks