EMAIL THIS PAGE TO A FRIEND

ARL2BP

ADP-ribosylation factor-like 2 binding protein

Synonyms: BART BART1
UniProtKB ID: Q9Y2Y0, B3KQJ5, Q504R0
Gene ID:
Human(23568) Summary: ADP-ribosylation factor (ARF)-like proteins (ARLs) comprise a functionally distinct group of the ARF family of RAS-related GTPases. The protein encoded by this gene binds to ARL2.GTP with high affinity but does not interact with ARL2.GDP, activated ARF, or RHO proteins. The lack of detectable membrane association of this protein or ARL2 upon activation of ARL2 is suggestive of actions distinct from those of the ARFs. This protein is considered to be the first ARL2-specific effector identified, due to its interaction with ARL2.GTP but lack of ARL2 GTPase-activating protein activity. [provided by RefSeq, Jul 2008]
Mouse(107566) ADP-ribosylation factor-like 2 binding protein
Rat(498910) ADP-ribosylation factor-like 2 binding protein
Zebrafish(393976) ADP-ribosylation factor-like 2 binding protein
chicken(426495) ADP-ribosylation factor-like 2 binding protein
cow(613462) ADP-ribosylation factor-like 2 binding protein
domestic cat(101084154) ADP-ribosylation factor-like 2 binding protein
dog(611248) ADP-ribosylation factor-like 2 binding protein
domestic guinea pig(100724484) ADP-ribosylation factor-like 2 binding protein
naked mole-rat(101698813) ADP-ribosylation factor-like 2 binding protein
sheep(100302309) ADP-ribosylation factor-like 2 binding protein
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012106 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012106 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012106 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024191 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024191 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024191 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012106 Rosetta Predictions human pricing
NM_001024906 Rosetta Predictions rat pricing
NM_024191 Rosetta Predictions mouse pricing
NM_024269 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012106 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080927 predicted 740
2 SASI_Hs01_00080928 predicted 1052
3 SASI_Hs01_00080930 predicted 839
4 SASI_Hs01_00080931 predicted 1037
5 SASI_Hs01_00080933 predicted 846
6 SASI_Hs01_00080935 predicted 814
7 SASI_Hs01_00080936 predicted 828
8 SASI_Hs02_00343630 predicted 770
9 SASI_Hs02_00343631 predicted 797
10 SASI_Hs02_00343632 predicted 688
11 SASI_Hs01_00080929 predicted 909
12 SASI_Hs01_00080932 predicted 663
13 SASI_Hs01_00080934 predicted 792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024906 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033394 predicted 262
2 SASI_Rn01_00033395 predicted 487
3 SASI_Rn01_00033396 predicted 1012
4 SASI_Rn01_00033397 predicted 395
5 SASI_Rn01_00033398 predicted 757
6 SASI_Rn01_00033399 predicted 953
7 SASI_Rn01_00033400 predicted 799
8 SASI_Rn01_00033401 predicted 1003
9 SASI_Rn01_00033402 predicted 737
10 SASI_Rn01_00033403 predicted 1082
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024191 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084515 predicted 506
2 SASI_Mm01_00084516 predicted 542
3 SASI_Mm01_00084518 predicted 386
4 SASI_Mm01_00084519 predicted 410
5 SASI_Mm01_00084520 predicted 438
6 SASI_Mm01_00084521 predicted 414
7 SASI_Mm01_00084522 predicted 503
8 SASI_Mm01_00084523 predicted 412
9 SASI_Mm01_00084524 predicted 522
10 SASI_Mm02_00327522 predicted 500
11 SASI_Mm01_00084517 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024269 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046376 predicted 480
2 SASI_Mm01_00046377 predicted 522
3 SASI_Mm01_00046379 predicted 367
4 SASI_Mm01_00046380 predicted 391
5 SASI_Mm01_00046381 predicted 412
6 SASI_Mm01_00046382 predicted 394
7 SASI_Mm01_00046383 predicted 484
8 SASI_Mm01_00046384 predicted 387
9 SASI_Mm01_00046385 predicted 501
10 SASI_Mm02_00327671 predicted 484
11 SASI_Mm01_00046378 predicted 379
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012106
VALIDATED
ARL2BP MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 2 binding protein
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012106.3-342s21c1
Sequence:CCGGGATGACGAGTTCCAGTTATTACTCGAGTAATAACTGGAACTCGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012106.3-675s21c1
Sequence:CCGGGTGACTTCATTGTGCAAATCACTCGAGTGATTTGCACAATGAAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012106.3-287s21c1
Sequence:CCGGCGCCTCTGATGCAGAATTTGACTCGAGTCAAATTCTGCATCAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012106.3-1800s21c1
Sequence:CCGGGCACAGCTTTACTGGCTGTTTCTCGAGAAACAGCCAGTAAAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_012106.3-287s1c1
Sequence:CCGGCGCCTCTGATGCAGAATTTGACTCGAGTCAAATTCTGCATCAGAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012106.3-342s1c1
Sequence:CCGGGATGACGAGTTCCAGTTATTACTCGAGTAATAACTGGAACTCGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012106.3-675s1c1
Sequence:CCGGGTGACTTCATTGTGCAAATCACTCGAGTGATTTGCACAATGAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012106.3-1814s1c1
Sequence:CCGGGCTGTTTGTATGCTTTGGTTTCTCGAGAAACCAAAGCATACAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137806    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012106.3-1800s1c1
Sequence:CCGGGCACAGCTTTACTGGCTGTTTCTCGAGAAACAGCCAGTAAAGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012106.3-575s1c1
Sequence:CCGGGCTGCTCACCTTCACAGATTTCTCGAGAAATCTGTGAAGGTGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012106.3-297s1c1
Sequence:CCGGGCAGAATTTGATGCTGTGGTTCTCGAGAACCACAGCATCAAATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012106.3-540s1c1
Sequence:CCGGCATAAGGATGAAGTGGCTGGTCTCGAGACCAGCCACTTCATCCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012106
VALIDATED
ARL2BP MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 2 binding protein
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012106.3-342s21c1
Sequence:CCGGGATGACGAGTTCCAGTTATTACTCGAGTAATAACTGGAACTCGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012106.3-675s21c1
Sequence:CCGGGTGACTTCATTGTGCAAATCACTCGAGTGATTTGCACAATGAAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012106.3-287s21c1
Sequence:CCGGCGCCTCTGATGCAGAATTTGACTCGAGTCAAATTCTGCATCAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012106.3-1800s21c1
Sequence:CCGGGCACAGCTTTACTGGCTGTTTCTCGAGAAACAGCCAGTAAAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_012106.3-287s1c1
Sequence:CCGGCGCCTCTGATGCAGAATTTGACTCGAGTCAAATTCTGCATCAGAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012106.3-342s1c1
Sequence:CCGGGATGACGAGTTCCAGTTATTACTCGAGTAATAACTGGAACTCGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012106.3-675s1c1
Sequence:CCGGGTGACTTCATTGTGCAAATCACTCGAGTGATTTGCACAATGAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012106.3-1814s1c1
Sequence:CCGGGCTGTTTGTATGCTTTGGTTTCTCGAGAAACCAAAGCATACAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137806    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012106.3-1800s1c1
Sequence:CCGGGCACAGCTTTACTGGCTGTTTCTCGAGAAACAGCCAGTAAAGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012106.3-575s1c1
Sequence:CCGGGCTGCTCACCTTCACAGATTTCTCGAGAAATCTGTGAAGGTGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012106.3-297s1c1
Sequence:CCGGGCAGAATTTGATGCTGTGGTTCTCGAGAACCACAGCATCAAATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012106.3-540s1c1
Sequence:CCGGCATAAGGATGAAGTGGCTGGTCTCGAGACCAGCCACTTCATCCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012106
VALIDATED
ARL2BP MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 2 binding protein
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012106.3-342s21c1
Sequence:CCGGGATGACGAGTTCCAGTTATTACTCGAGTAATAACTGGAACTCGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012106.3-675s21c1
Sequence:CCGGGTGACTTCATTGTGCAAATCACTCGAGTGATTTGCACAATGAAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012106.3-287s21c1
Sequence:CCGGCGCCTCTGATGCAGAATTTGACTCGAGTCAAATTCTGCATCAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012106.3-1800s21c1
Sequence:CCGGGCACAGCTTTACTGGCTGTTTCTCGAGAAACAGCCAGTAAAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_012106.3-287s1c1
Sequence:CCGGCGCCTCTGATGCAGAATTTGACTCGAGTCAAATTCTGCATCAGAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012106.3-342s1c1
Sequence:CCGGGATGACGAGTTCCAGTTATTACTCGAGTAATAACTGGAACTCGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012106.3-675s1c1
Sequence:CCGGGTGACTTCATTGTGCAAATCACTCGAGTGATTTGCACAATGAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012106.3-1814s1c1
Sequence:CCGGGCTGTTTGTATGCTTTGGTTTCTCGAGAAACCAAAGCATACAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137806    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012106.3-1800s1c1
Sequence:CCGGGCACAGCTTTACTGGCTGTTTCTCGAGAAACAGCCAGTAAAGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012106.3-575s1c1
Sequence:CCGGGCTGCTCACCTTCACAGATTTCTCGAGAAATCTGTGAAGGTGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012106.3-297s1c1
Sequence:CCGGGCAGAATTTGATGCTGTGGTTCTCGAGAACCACAGCATCAAATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012106.3-540s1c1
Sequence:CCGGCATAAGGATGAAGTGGCTGGTCTCGAGACCAGCCACTTCATCCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024191
VALIDATED
ARL2BP MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 2 binding protein
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000258061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024191.1-185s21c1
Sequence:CCGGGGATGTTTAGAGGACATTATTCTCGAGAATAATGTCCTCTAAACATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024191.1-656s21c1
Sequence:CCGGTCCGAGAAACATGGGCTAATGCTCGAGCATTAGCCCATGTTTCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024191.1-442s21c1
Sequence:CCGGGCTGCTCACATTCACGGATTTCTCGAGAAATCCGTGAATGTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024191.1-277s21c1
Sequence:CCGGAGAGAATAAACTCACCTATACCTCGAGGTATAGGTGAGTTTATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024191
VALIDATED
ARL2BP MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 2 binding protein
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000258061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024191.1-185s21c1
Sequence:CCGGGGATGTTTAGAGGACATTATTCTCGAGAATAATGTCCTCTAAACATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024191.1-656s21c1
Sequence:CCGGTCCGAGAAACATGGGCTAATGCTCGAGCATTAGCCCATGTTTCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024191.1-442s21c1
Sequence:CCGGGCTGCTCACATTCACGGATTTCTCGAGAAATCCGTGAATGTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024191.1-277s21c1
Sequence:CCGGAGAGAATAAACTCACCTATACCTCGAGGTATAGGTGAGTTTATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024191
VALIDATED
ARL2BP MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 2 binding protein
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000258061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024191.1-185s21c1
Sequence:CCGGGGATGTTTAGAGGACATTATTCTCGAGAATAATGTCCTCTAAACATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024191.1-656s21c1
Sequence:CCGGTCCGAGAAACATGGGCTAATGCTCGAGCATTAGCCCATGTTTCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024191.1-442s21c1
Sequence:CCGGGCTGCTCACATTCACGGATTTCTCGAGAAATCCGTGAATGTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024191.1-277s21c1
Sequence:CCGGAGAGAATAAACTCACCTATACCTCGAGGTATAGGTGAGTTTATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks