EMAIL THIS PAGE TO A FRIEND

ARL3

ADP-ribosylation factor-like 3

Synonyms: ARFL3
UniProtKB ID: P36405, B2R6C7, Q53X83, Q5JSM2
Gene ID:
Human(403) Summary: ADP-ribosylation factor-like 3 is a member of the ADP-ribosylation factor family of GTP-binding proteins. ARL3 binds guanine nucleotides but lacks ADP-ribosylation factor activity. [provided by RefSeq, Jul 2008]
Mouse(56350) ADP-ribosylation factor-like 3
Rat(64664) ADP-ribosylation factor-like 3
Zebrafish(797451) ADP-ribosylation factor-like 3
cow(540040) ADP-ribosylation factor-like 3
domestic cat(101082345) ADP-ribosylation factor-like 3
dog(477806) ADP-ribosylation factor-like 3
chicken(423865) ADP-ribosylation factor-like 3
sheep(100302311) ADP-ribosylation factor-like 3
naked mole-rat(101726126) ADP-ribosylation factor-like 3
domestic guinea pig(100723389) ADP-ribosylation factor-like 3
211 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004311 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004311 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004311 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019718 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019718 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019718 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004311 Rosetta Predictions human pricing
NM_022700 Rosetta Predictions rat pricing
NM_019718 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004311 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049644 predicted 663
2 SASI_Hs01_00049645 predicted 622
3 SASI_Hs01_00049646 predicted 738
4 SASI_Hs01_00049647 predicted 647
5 SASI_Hs01_00049648 predicted 511
6 SASI_Hs01_00049649 predicted 351
7 SASI_Hs01_00049650 predicted 580
8 SASI_Hs01_00049651 predicted 769
9 SASI_Hs01_00049652 predicted 506
10 SASI_Hs02_00337338 predicted 380
11 SASI_Hs01_00049653 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022700 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263504 predicted 431
2 SASI_Rn01_00079070 predicted 224
3 SASI_Rn01_00079071 predicted 466
4 SASI_Rn01_00079073 predicted 428
5 SASI_Rn01_00079074 predicted 355
6 SASI_Rn01_00079075 predicted 530
7 SASI_Rn01_00079076 predicted 409
8 SASI_Rn01_00079077 predicted 260
9 SASI_Rn01_00079078 predicted 261
10 SASI_Rn01_00079079 predicted 234
11 SASI_Rn01_00079072 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019718 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179261 predicted 542
2 SASI_Mm01_00179262 predicted 552
3 SASI_Mm01_00179263 predicted 466
4 SASI_Mm01_00179264 predicted 554
5 SASI_Mm01_00179265 predicted 390
6 SASI_Mm01_00179266 predicted 543
7 SASI_Mm02_00324842 predicted 549
8 SASI_Mm01_00179268 predicted 459
9 SASI_Mm01_00179269 predicted 297
10 SASI_Mm01_00179270 predicted 493
11 SASI_Mm01_00179267 predicted 361
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004311
VALIDATED
ARL3 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 3
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004311.2-2767s1c1
Sequence:CCGGCCTCTGTAAATGTTCTGATTTCTCGAGAAATCAGAACATTTACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004311.2-290s1c1
Sequence:CCGGCATCACACCTACACAGGGTTTCTCGAGAAACCCTGTGTAGGTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004311.2-516s1c1
Sequence:CCGGCCAGTGCTCATCTTTGCTAATCTCGAGATTAGCAAAGATGAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004311.2-480s1c1
Sequence:CCGGGCGGAATTACTGGAGGAAGAACTCGAGTTCTTCCTCCAGTAATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004311.2-201s1c1
Sequence:CCGGGACCAGGAGGTGAGAATACTTCTCGAGAAGTATTCTCACCTCCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004311.2-825s21c1
Sequence:GTACCGGGAGAGGGAACAACACGGTTTACTCGAGTAAACCGTGTTGTTCCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004311.2-1161s21c1
Sequence:GTACCGGTGCTGGTGCTGTCAGTGATTTCTCGAGAAATCACTGACAGCACCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004311.2-1007s21c1
Sequence:GTACCGGGCATTGCAGTTTAGACAATTCCTCGAGGAATTGTCTAAACTGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004311.2-516s21c1
Sequence:CCGGCCAGTGCTCATCTTTGCTAATCTCGAGATTAGCAAAGATGAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004311.2-201s21c1
Sequence:CCGGGACCAGGAGGTGAGAATACTTCTCGAGAAGTATTCTCACCTCCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004311.2-480s21c1
Sequence:CCGGGCGGAATTACTGGAGGAAGAACTCGAGTTCTTCCTCCAGTAATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004311.2-290s21c1
Sequence:CCGGCATCACACCTACACAGGGTTTCTCGAGAAACCCTGTGTAGGTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004311.2-954s21c1
Sequence:GTACCGGATGTCTCAAAGCACATGATTACTCGAGTAATCATGTGCTTTGAGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004311.2-578s21c1
Sequence:GTACCGGAGAAGGACTGAACCTGCATACCTCGAGGTATGCAGGTTCAGTCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004311.2-430s21c1
Sequence:GTACCGGTAATCGACAGTGCAGACAGAACTCGAGTTCTGTCTGCACTGTCGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004311
VALIDATED
ARL3 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 3
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004311.2-2767s1c1
Sequence:CCGGCCTCTGTAAATGTTCTGATTTCTCGAGAAATCAGAACATTTACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004311.2-290s1c1
Sequence:CCGGCATCACACCTACACAGGGTTTCTCGAGAAACCCTGTGTAGGTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004311.2-516s1c1
Sequence:CCGGCCAGTGCTCATCTTTGCTAATCTCGAGATTAGCAAAGATGAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004311.2-480s1c1
Sequence:CCGGGCGGAATTACTGGAGGAAGAACTCGAGTTCTTCCTCCAGTAATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004311.2-201s1c1
Sequence:CCGGGACCAGGAGGTGAGAATACTTCTCGAGAAGTATTCTCACCTCCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004311.2-825s21c1
Sequence:GTACCGGGAGAGGGAACAACACGGTTTACTCGAGTAAACCGTGTTGTTCCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004311.2-1161s21c1
Sequence:GTACCGGTGCTGGTGCTGTCAGTGATTTCTCGAGAAATCACTGACAGCACCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004311.2-1007s21c1
Sequence:GTACCGGGCATTGCAGTTTAGACAATTCCTCGAGGAATTGTCTAAACTGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004311.2-516s21c1
Sequence:CCGGCCAGTGCTCATCTTTGCTAATCTCGAGATTAGCAAAGATGAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004311.2-201s21c1
Sequence:CCGGGACCAGGAGGTGAGAATACTTCTCGAGAAGTATTCTCACCTCCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004311.2-480s21c1
Sequence:CCGGGCGGAATTACTGGAGGAAGAACTCGAGTTCTTCCTCCAGTAATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004311.2-290s21c1
Sequence:CCGGCATCACACCTACACAGGGTTTCTCGAGAAACCCTGTGTAGGTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004311.2-954s21c1
Sequence:GTACCGGATGTCTCAAAGCACATGATTACTCGAGTAATCATGTGCTTTGAGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004311.2-578s21c1
Sequence:GTACCGGAGAAGGACTGAACCTGCATACCTCGAGGTATGCAGGTTCAGTCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004311.2-430s21c1
Sequence:GTACCGGTAATCGACAGTGCAGACAGAACTCGAGTTCTGTCTGCACTGTCGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004311
VALIDATED
ARL3 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 3
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004311.2-2767s1c1
Sequence:CCGGCCTCTGTAAATGTTCTGATTTCTCGAGAAATCAGAACATTTACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004311.2-290s1c1
Sequence:CCGGCATCACACCTACACAGGGTTTCTCGAGAAACCCTGTGTAGGTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004311.2-516s1c1
Sequence:CCGGCCAGTGCTCATCTTTGCTAATCTCGAGATTAGCAAAGATGAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004311.2-480s1c1
Sequence:CCGGGCGGAATTACTGGAGGAAGAACTCGAGTTCTTCCTCCAGTAATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004311.2-201s1c1
Sequence:CCGGGACCAGGAGGTGAGAATACTTCTCGAGAAGTATTCTCACCTCCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004311.2-825s21c1
Sequence:GTACCGGGAGAGGGAACAACACGGTTTACTCGAGTAAACCGTGTTGTTCCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004311.2-1161s21c1
Sequence:GTACCGGTGCTGGTGCTGTCAGTGATTTCTCGAGAAATCACTGACAGCACCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004311.2-1007s21c1
Sequence:GTACCGGGCATTGCAGTTTAGACAATTCCTCGAGGAATTGTCTAAACTGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004311.2-516s21c1
Sequence:CCGGCCAGTGCTCATCTTTGCTAATCTCGAGATTAGCAAAGATGAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004311.2-201s21c1
Sequence:CCGGGACCAGGAGGTGAGAATACTTCTCGAGAAGTATTCTCACCTCCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004311.2-480s21c1
Sequence:CCGGGCGGAATTACTGGAGGAAGAACTCGAGTTCTTCCTCCAGTAATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004311.2-290s21c1
Sequence:CCGGCATCACACCTACACAGGGTTTCTCGAGAAACCCTGTGTAGGTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004311.2-954s21c1
Sequence:GTACCGGATGTCTCAAAGCACATGATTACTCGAGTAATCATGTGCTTTGAGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004311.2-578s21c1
Sequence:GTACCGGAGAAGGACTGAACCTGCATACCTCGAGGTATGCAGGTTCAGTCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004311.2-430s21c1
Sequence:GTACCGGTAATCGACAGTGCAGACAGAACTCGAGTTCTGTCTGCACTGTCGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019718
VALIDATED
ARL3 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 3
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100925    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019718.2-655s1c1
Sequence:CCGGGTTGCTGCTTTCTGACCAAATCTCGAGATTTGGTCAGAAAGCAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019718.2-562s1c1
Sequence:CCGGCTGCAAGAATGTCAACGCAAACTCGAGTTTGCGTTGACATTCTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019718.2-326s1c1
Sequence:CCGGGCCGACAGAAAGAGATTTGAACTCGAGTTCAAATCTCTTTCTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019718.2-366s1c1
Sequence:CCGGCGGAATTACTGGAGGAAGAAACTCGAGTTTCTTCCTCCAGTAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019718.2-148s1c1
Sequence:CCGGGCAACTCGCATCTGAAGACATCTCGAGATGTCTTCAGATGCGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019718.2-294s21c1
Sequence:GTACCGGATACTGATATTCTCATCTATGCTCGAGCATAGATGAGAATATCAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019718.2-366s21c1
Sequence:CCGGCGGAATTACTGGAGGAAGAAACTCGAGTTTCTTCCTCCAGTAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019718.2-326s21c1
Sequence:CCGGGCCGACAGAAAGAGATTTGAACTCGAGTTCAAATCTCTTTCTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019718.2-148s21c1
Sequence:CCGGGCAACTCGCATCTGAAGACATCTCGAGATGTCTTCAGATGCGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019718.2-655s21c1
Sequence:CCGGGTTGCTGCTTTCTGACCAAATCTCGAGATTTGGTCAGAAAGCAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019718.2-552s21c1
Sequence:GTACCGGTGAACTGGGTCTGCAAGAATGCTCGAGCATTCTTGCAGACCCAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019718.2-178s21c1
Sequence:GTACCGGCACACCTACACAGGGATTTAACTCGAGTTAAATCCCTGTGTAGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019718
VALIDATED
ARL3 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 3
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100925    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019718.2-655s1c1
Sequence:CCGGGTTGCTGCTTTCTGACCAAATCTCGAGATTTGGTCAGAAAGCAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019718.2-562s1c1
Sequence:CCGGCTGCAAGAATGTCAACGCAAACTCGAGTTTGCGTTGACATTCTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019718.2-326s1c1
Sequence:CCGGGCCGACAGAAAGAGATTTGAACTCGAGTTCAAATCTCTTTCTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019718.2-366s1c1
Sequence:CCGGCGGAATTACTGGAGGAAGAAACTCGAGTTTCTTCCTCCAGTAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019718.2-148s1c1
Sequence:CCGGGCAACTCGCATCTGAAGACATCTCGAGATGTCTTCAGATGCGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019718.2-294s21c1
Sequence:GTACCGGATACTGATATTCTCATCTATGCTCGAGCATAGATGAGAATATCAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019718.2-366s21c1
Sequence:CCGGCGGAATTACTGGAGGAAGAAACTCGAGTTTCTTCCTCCAGTAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019718.2-326s21c1
Sequence:CCGGGCCGACAGAAAGAGATTTGAACTCGAGTTCAAATCTCTTTCTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019718.2-148s21c1
Sequence:CCGGGCAACTCGCATCTGAAGACATCTCGAGATGTCTTCAGATGCGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019718.2-655s21c1
Sequence:CCGGGTTGCTGCTTTCTGACCAAATCTCGAGATTTGGTCAGAAAGCAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019718.2-552s21c1
Sequence:GTACCGGTGAACTGGGTCTGCAAGAATGCTCGAGCATTCTTGCAGACCCAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019718.2-178s21c1
Sequence:GTACCGGCACACCTACACAGGGATTTAACTCGAGTTAAATCCCTGTGTAGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019718
VALIDATED
ARL3 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 3
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100925    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019718.2-655s1c1
Sequence:CCGGGTTGCTGCTTTCTGACCAAATCTCGAGATTTGGTCAGAAAGCAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019718.2-562s1c1
Sequence:CCGGCTGCAAGAATGTCAACGCAAACTCGAGTTTGCGTTGACATTCTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019718.2-326s1c1
Sequence:CCGGGCCGACAGAAAGAGATTTGAACTCGAGTTCAAATCTCTTTCTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019718.2-366s1c1
Sequence:CCGGCGGAATTACTGGAGGAAGAAACTCGAGTTTCTTCCTCCAGTAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019718.2-148s1c1
Sequence:CCGGGCAACTCGCATCTGAAGACATCTCGAGATGTCTTCAGATGCGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019718.2-294s21c1
Sequence:GTACCGGATACTGATATTCTCATCTATGCTCGAGCATAGATGAGAATATCAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019718.2-366s21c1
Sequence:CCGGCGGAATTACTGGAGGAAGAAACTCGAGTTTCTTCCTCCAGTAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019718.2-326s21c1
Sequence:CCGGGCCGACAGAAAGAGATTTGAACTCGAGTTCAAATCTCTTTCTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019718.2-148s21c1
Sequence:CCGGGCAACTCGCATCTGAAGACATCTCGAGATGTCTTCAGATGCGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019718.2-655s21c1
Sequence:CCGGGTTGCTGCTTTCTGACCAAATCTCGAGATTTGGTCAGAAAGCAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019718.2-552s21c1
Sequence:GTACCGGTGAACTGGGTCTGCAAGAATGCTCGAGCATTCTTGCAGACCCAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019718.2-178s21c1
Sequence:GTACCGGCACACCTACACAGGGATTTAACTCGAGTTAAATCCCTGTGTAGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks