EMAIL THIS PAGE TO A FRIEND

ARL4A

ADP-ribosylation factor-like 4A

233 Gene Product Result for
Synonyms: ARL4
UniProtKB ID: P40617, A4D119, P80418, Q49AF5
Gene ID:
Human(10124) Summary: ADP-ribosylation factor-like 4A is a member of the ADP-ribosylation factor family of GTP-binding proteins. ARL4A is similar to ARL4C and ARL4D and each has a nuclear localization signal and an unusually high guaninine nucleotide exchange rate. ARL4A is located in both the nuclear and extranuclear cell compartments. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(11861) ADP-ribosylation factor-like 4A
Rat(29308) ADP-ribosylation factor-like 4A
chicken(420589) ADP-ribosylation factor-like 4A
domestic cat(101101452) ADP-ribosylation factor-like 4A
cow(767906) ADP-ribosylation factor-like 4A
sheep(100145881) ADP-ribosylation factor-like 4A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005738 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005738 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005738 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007487 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007487 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007487 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037164 Rosetta Predictions human pricing
NM_005738 Rosetta Predictions human pricing
NM_212460 Rosetta Predictions human pricing
NM_019186 Rosetta Predictions rat pricing
NM_001039515 Rosetta Predictions mouse pricing
NM_007487 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308226 predicted 572
2 SASI_Hs01_00223967 predicted 551
3 SASI_Hs02_00308227 predicted 548
4 SASI_Hs01_00223971 predicted 412
5 SASI_Hs02_00308228 predicted 529
6 SASI_Hs01_00223963 predicted 713
7 SASI_Hs01_00223964 predicted 1150
8 SASI_Hs02_00308229 predicted 804
9 SASI_Hs01_00223965 predicted 658
10 SASI_Hs01_00223966 predicted 741
11 SASI_Hs01_00223968 predicted 1141
12 SASI_Hs01_00223969 predicted 1116
13 SASI_Hs01_00223970 predicted 1064
14 SASI_Hs01_00223972 predicted 665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340176 predicted 777
2 SASI_Hs01_00159827 predicted 759
3 SASI_Hs02_00340177 predicted 750
4 SASI_Hs01_00159831 predicted 617
5 SASI_Hs02_00340178 predicted 739
6 SASI_Hs01_00159823 predicted 921
7 SASI_Hs01_00159824 predicted 1355
8 SASI_Hs02_00340179 predicted 1013
9 SASI_Hs01_00159825 predicted 862
10 SASI_Hs01_00159826 predicted 949
11 SASI_Hs01_00159828 predicted 1350
12 SASI_Hs01_00159829 predicted 1322
13 SASI_Hs01_00159830 predicted 1259
14 SASI_Hs01_00159832 predicted 864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374177 predicted 569
2 SASI_Hs01_00029342 predicted 553
3 SASI_Hs02_00374178 predicted 541
4 SASI_Hs01_00029346 predicted 410
5 SASI_Hs02_00374179 predicted 532
6 SASI_Hs01_00029338 predicted 711
7 SASI_Hs01_00029339 predicted 1154
8 SASI_Hs02_00374180 predicted 799
9 SASI_Hs01_00029340 predicted 649
10 SASI_Hs01_00029341 predicted 738
11 SASI_Hs01_00029343 predicted 1137
12 SASI_Hs01_00029344 predicted 1113
13 SASI_Hs01_00029345 predicted 1060
14 SASI_Hs01_00029347 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019186 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040300 predicted 221
2 SASI_Rn01_00040301 predicted 531
3 SASI_Rn02_00261995 predicted 490
4 SASI_Rn01_00040302 predicted 354
5 SASI_Rn01_00040303 predicted 549
6 SASI_Rn01_00040304 predicted 622
7 SASI_Rn01_00040305 predicted 247
8 SASI_Rn01_00040306 predicted 367
9 SASI_Rn01_00040307 predicted 388
10 SASI_Rn01_00040308 predicted 232
11 SASI_Rn01_00040309 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039515 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196735 predicted 1116
2 SASI_Mm01_00196736 predicted 417
3 SASI_Mm01_00196737 predicted 765
4 SASI_Mm01_00196738 predicted 831
5 SASI_Mm02_00290109 predicted 621
6 SASI_Mm01_00196739 predicted 749
7 SASI_Mm01_00196741 predicted 885
8 SASI_Mm01_00196742 predicted 365
9 SASI_Mm01_00196743 predicted 518
10 SASI_Mm01_00196744 predicted 665
11 SASI_Mm01_00196740 predicted 1023
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007487 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157976 predicted 1082
2 SASI_Mm01_00157977 predicted 378
3 SASI_Mm01_00157978 predicted 736
4 SASI_Mm01_00157979 predicted 793
5 SASI_Mm02_00311755 predicted 576
6 SASI_Mm01_00157980 predicted 715
7 SASI_Mm01_00157982 predicted 855
8 SASI_Mm01_00157983 predicted 325
9 SASI_Mm01_00157984 predicted 475
10 SASI_Mm01_00157985 predicted 629
11 SASI_Mm01_00157981 predicted 979
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005738
VALIDATED
ARL4A MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 4A
Human
27 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-771s21c1
Sequence:GTACCGGGTATTTGTTGTGGACTCTGTTCTCGAGAACAGAGTCCACAACAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-990s21c1
Sequence:GTACCGGATCATAGGAGATGGCCTAAAGCTCGAGCTTTAGGCCATCTCCTATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005738.3-976s21c1
Sequence:CCGGAGCCTACCTGTGCAATCATAGCTCGAGCTATGATTGCACAGGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005738.3-868s21c1
Sequence:CCGGTACTTATAGTTGCTAACAAACCTCGAGGTTTGTTAGCAACTATAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005738.3-755s21c1
Sequence:CCGGATGCACAGATGGCATTGTATTCTCGAGAATACAATGCCATCTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005738.3-2912s21c1
Sequence:CCGGGTAGATCCATGATGGATTAATCTCGAGATTAATCCATCATGGATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-1016s21c1
Sequence:CCGGACTTGAGAAACTACATGATATCTCGAGATATCATGTAGTTTCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-916s21c1
Sequence:GTACCGGCAGAAATTGAGAAATTGTTAGCTCGAGCTAACAATTTCTCAATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-783s21c1
Sequence:GTACCGGGACTCTGTTGATGTCGAAAGGCTCGAGCCTTTCGACATCAACAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005738.3-1525s21c1
Sequence:GTACCGGGCAGTTATATTGATCACATTGCTCGAGCAATGTGATCAATATAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-592s21c1
Sequence:GTACCGGTATACAGGCTGCAGTTCAATGCTCGAGCATTGAACTGCAGCCTGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-710s21c1
Sequence:GTACCGGAGGTGGTCAGGAGAAATTAAGCTCGAGCTTAATTTCTCCTGACCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-730s21c1
Sequence:GTACCGGGGCCACTGTGGAAGTCATATACTCGAGTATATGACTTCCACAGTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-941s21c1
Sequence:GTACCGGGGGTGAACTGAGCTCATCAACCTCGAGGTTGATGAGCTCAGTTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-896s21c1
Sequence:GTACCGGGAGGAACTCATTGTCACTTTCCTCGAGGAAAGTGACAATGAGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-517s21c1
Sequence:GTACCGGTGTCCAACCTGCCTTCATTTCCTCGAGGAAATGAAGGCAGGTTGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005738.3-1571s21c1
Sequence:GTACCGGAGGGACAAGGAGTAAGTATTTCTCGAGAAATACTTACTCCTTGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-1001s21c1
Sequence:GTACCGGTGGCCTAAAGGAAGGACTTGACTCGAGTCAAGTCCTTCCTTTAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-561s21c1
Sequence:GTACCGGGGTTTGGACTGTGCTGGAAAGCTCGAGCTTTCCAGCACAGTCCAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-954s21c1
Sequence:GTACCGGTCATCAACTCCTTGGCATTTGCTCGAGCAAATGCCAAGGAGTTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-854s21c1
Sequence:GTACCGGTCAGGGAGTCCCTGTACTTATCTCGAGATAAGTACAGGGACTCCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-929s21c1
Sequence:GTACCGGATTGTTAGCAATGGGTGAACTCTCGAGAGTTCACCCATTGCTAACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005738.1-534s1c1
Sequence:CCGGCCCTGTACTTATAGTTGCTAACTCGAGTTAGCAACTATAAGTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005738.1-623s1c1
Sequence:CCGGGCTCATCAACTCCTTGGCATTCTCGAGAATGCCAAGGAGTTGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005738.1-195s1c1
Sequence:CCGGCCTGCCTTCATTTCAGTCTTTCTCGAGAAAGACTGAAATGAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005738.1-208s1c1
Sequence:CCGGCAGTCTTTCCACATTGTTATTCTCGAGAATAACAATGTGGAAAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005738.1-558s1c1
Sequence:CCGGACAAGATTTGAGGAACTCATTCTCGAGAATGAGTTCCTCAAATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005738
VALIDATED
ARL4A MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 4A
Human
27 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-771s21c1
Sequence:GTACCGGGTATTTGTTGTGGACTCTGTTCTCGAGAACAGAGTCCACAACAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-990s21c1
Sequence:GTACCGGATCATAGGAGATGGCCTAAAGCTCGAGCTTTAGGCCATCTCCTATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005738.3-976s21c1
Sequence:CCGGAGCCTACCTGTGCAATCATAGCTCGAGCTATGATTGCACAGGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005738.3-868s21c1
Sequence:CCGGTACTTATAGTTGCTAACAAACCTCGAGGTTTGTTAGCAACTATAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005738.3-755s21c1
Sequence:CCGGATGCACAGATGGCATTGTATTCTCGAGAATACAATGCCATCTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005738.3-2912s21c1
Sequence:CCGGGTAGATCCATGATGGATTAATCTCGAGATTAATCCATCATGGATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-1016s21c1
Sequence:CCGGACTTGAGAAACTACATGATATCTCGAGATATCATGTAGTTTCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-916s21c1
Sequence:GTACCGGCAGAAATTGAGAAATTGTTAGCTCGAGCTAACAATTTCTCAATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-783s21c1
Sequence:GTACCGGGACTCTGTTGATGTCGAAAGGCTCGAGCCTTTCGACATCAACAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005738.3-1525s21c1
Sequence:GTACCGGGCAGTTATATTGATCACATTGCTCGAGCAATGTGATCAATATAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-592s21c1
Sequence:GTACCGGTATACAGGCTGCAGTTCAATGCTCGAGCATTGAACTGCAGCCTGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-710s21c1
Sequence:GTACCGGAGGTGGTCAGGAGAAATTAAGCTCGAGCTTAATTTCTCCTGACCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-730s21c1
Sequence:GTACCGGGGCCACTGTGGAAGTCATATACTCGAGTATATGACTTCCACAGTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-941s21c1
Sequence:GTACCGGGGGTGAACTGAGCTCATCAACCTCGAGGTTGATGAGCTCAGTTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-896s21c1
Sequence:GTACCGGGAGGAACTCATTGTCACTTTCCTCGAGGAAAGTGACAATGAGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-517s21c1
Sequence:GTACCGGTGTCCAACCTGCCTTCATTTCCTCGAGGAAATGAAGGCAGGTTGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005738.3-1571s21c1
Sequence:GTACCGGAGGGACAAGGAGTAAGTATTTCTCGAGAAATACTTACTCCTTGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-1001s21c1
Sequence:GTACCGGTGGCCTAAAGGAAGGACTTGACTCGAGTCAAGTCCTTCCTTTAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-561s21c1
Sequence:GTACCGGGGTTTGGACTGTGCTGGAAAGCTCGAGCTTTCCAGCACAGTCCAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-954s21c1
Sequence:GTACCGGTCATCAACTCCTTGGCATTTGCTCGAGCAAATGCCAAGGAGTTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-854s21c1
Sequence:GTACCGGTCAGGGAGTCCCTGTACTTATCTCGAGATAAGTACAGGGACTCCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-929s21c1
Sequence:GTACCGGATTGTTAGCAATGGGTGAACTCTCGAGAGTTCACCCATTGCTAACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005738.1-534s1c1
Sequence:CCGGCCCTGTACTTATAGTTGCTAACTCGAGTTAGCAACTATAAGTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005738.1-623s1c1
Sequence:CCGGGCTCATCAACTCCTTGGCATTCTCGAGAATGCCAAGGAGTTGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005738.1-195s1c1
Sequence:CCGGCCTGCCTTCATTTCAGTCTTTCTCGAGAAAGACTGAAATGAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005738.1-208s1c1
Sequence:CCGGCAGTCTTTCCACATTGTTATTCTCGAGAATAACAATGTGGAAAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005738.1-558s1c1
Sequence:CCGGACAAGATTTGAGGAACTCATTCTCGAGAATGAGTTCCTCAAATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005738
VALIDATED
ARL4A MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 4A
Human
27 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-771s21c1
Sequence:GTACCGGGTATTTGTTGTGGACTCTGTTCTCGAGAACAGAGTCCACAACAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-990s21c1
Sequence:GTACCGGATCATAGGAGATGGCCTAAAGCTCGAGCTTTAGGCCATCTCCTATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005738.3-976s21c1
Sequence:CCGGAGCCTACCTGTGCAATCATAGCTCGAGCTATGATTGCACAGGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005738.3-868s21c1
Sequence:CCGGTACTTATAGTTGCTAACAAACCTCGAGGTTTGTTAGCAACTATAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005738.3-755s21c1
Sequence:CCGGATGCACAGATGGCATTGTATTCTCGAGAATACAATGCCATCTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005738.3-2912s21c1
Sequence:CCGGGTAGATCCATGATGGATTAATCTCGAGATTAATCCATCATGGATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-1016s21c1
Sequence:CCGGACTTGAGAAACTACATGATATCTCGAGATATCATGTAGTTTCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-916s21c1
Sequence:GTACCGGCAGAAATTGAGAAATTGTTAGCTCGAGCTAACAATTTCTCAATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-783s21c1
Sequence:GTACCGGGACTCTGTTGATGTCGAAAGGCTCGAGCCTTTCGACATCAACAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005738.3-1525s21c1
Sequence:GTACCGGGCAGTTATATTGATCACATTGCTCGAGCAATGTGATCAATATAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-592s21c1
Sequence:GTACCGGTATACAGGCTGCAGTTCAATGCTCGAGCATTGAACTGCAGCCTGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-710s21c1
Sequence:GTACCGGAGGTGGTCAGGAGAAATTAAGCTCGAGCTTAATTTCTCCTGACCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-730s21c1
Sequence:GTACCGGGGCCACTGTGGAAGTCATATACTCGAGTATATGACTTCCACAGTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-941s21c1
Sequence:GTACCGGGGGTGAACTGAGCTCATCAACCTCGAGGTTGATGAGCTCAGTTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-896s21c1
Sequence:GTACCGGGAGGAACTCATTGTCACTTTCCTCGAGGAAAGTGACAATGAGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-517s21c1
Sequence:GTACCGGTGTCCAACCTGCCTTCATTTCCTCGAGGAAATGAAGGCAGGTTGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005738.3-1571s21c1
Sequence:GTACCGGAGGGACAAGGAGTAAGTATTTCTCGAGAAATACTTACTCCTTGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-1001s21c1
Sequence:GTACCGGTGGCCTAAAGGAAGGACTTGACTCGAGTCAAGTCCTTCCTTTAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-561s21c1
Sequence:GTACCGGGGTTTGGACTGTGCTGGAAAGCTCGAGCTTTCCAGCACAGTCCAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-954s21c1
Sequence:GTACCGGTCATCAACTCCTTGGCATTTGCTCGAGCAAATGCCAAGGAGTTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-854s21c1
Sequence:GTACCGGTCAGGGAGTCCCTGTACTTATCTCGAGATAAGTACAGGGACTCCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005738.3-929s21c1
Sequence:GTACCGGATTGTTAGCAATGGGTGAACTCTCGAGAGTTCACCCATTGCTAACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005738.1-534s1c1
Sequence:CCGGCCCTGTACTTATAGTTGCTAACTCGAGTTAGCAACTATAAGTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005738.1-623s1c1
Sequence:CCGGGCTCATCAACTCCTTGGCATTCTCGAGAATGCCAAGGAGTTGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005738.1-195s1c1
Sequence:CCGGCCTGCCTTCATTTCAGTCTTTCTCGAGAAAGACTGAAATGAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005738.1-208s1c1
Sequence:CCGGCAGTCTTTCCACATTGTTATTCTCGAGAATAACAATGTGGAAAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005738.1-558s1c1
Sequence:CCGGACAAGATTTGAGGAACTCATTCTCGAGAATGAGTTCCTCAAATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007487
VALIDATED
ARL4A MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 4A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007487.3-709s21c1
Sequence:CCGGATCATAGGAGATGGGCTAAAGCTCGAGCTTTAGCCCATCTCCTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007487.3-470s21c1
Sequence:CCGGCCCGATGCACAGATGGTATTGCTCGAGCAATACCATCTGTGCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007487.3-1264s21c1
Sequence:CCGGAGTTGAACACGCTGCGATAAGCTCGAGCTTATCGCAGCGTGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007487.3-320s21c1
Sequence:CCGGTGCAGTTCAACGAATTTGTAACTCGAGTTACAAATTCGTTGAACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007487.3-345s21c1
Sequence:CCGGCGTACCTACCAAAGGATTTAACTCGAGTTAAATCCTTTGGTAGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007487.2-305s1c1
Sequence:CCGGCGTACCTACCAAAGGATTTAACTCGAGTTAAATCCTTTGGTAGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007487.2-698s1c1
Sequence:CCGGCGAGAAACTACATGATATGATCTCGAGATCATATCATGTAGTTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007487.2-280s1c1
Sequence:CCGGTGCAGTTCAACGAATTTGTAACTCGAGTTACAAATTCGTTGAACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007487.2-543s1c1
Sequence:CCGGCCTGTGCTTATAGTTGCTAATCTCGAGATTAGCAACTATAAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007487.2-1518s1c1
Sequence:CCGGGCGCACTATTACTTGAACCTACTCGAGTAGGTTCAAGTAATAGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007487
VALIDATED
ARL4A MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 4A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007487.3-709s21c1
Sequence:CCGGATCATAGGAGATGGGCTAAAGCTCGAGCTTTAGCCCATCTCCTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007487.3-470s21c1
Sequence:CCGGCCCGATGCACAGATGGTATTGCTCGAGCAATACCATCTGTGCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007487.3-1264s21c1
Sequence:CCGGAGTTGAACACGCTGCGATAAGCTCGAGCTTATCGCAGCGTGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007487.3-320s21c1
Sequence:CCGGTGCAGTTCAACGAATTTGTAACTCGAGTTACAAATTCGTTGAACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007487.3-345s21c1
Sequence:CCGGCGTACCTACCAAAGGATTTAACTCGAGTTAAATCCTTTGGTAGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007487.2-305s1c1
Sequence:CCGGCGTACCTACCAAAGGATTTAACTCGAGTTAAATCCTTTGGTAGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007487.2-698s1c1
Sequence:CCGGCGAGAAACTACATGATATGATCTCGAGATCATATCATGTAGTTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007487.2-280s1c1
Sequence:CCGGTGCAGTTCAACGAATTTGTAACTCGAGTTACAAATTCGTTGAACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007487.2-543s1c1
Sequence:CCGGCCTGTGCTTATAGTTGCTAATCTCGAGATTAGCAACTATAAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007487.2-1518s1c1
Sequence:CCGGGCGCACTATTACTTGAACCTACTCGAGTAGGTTCAAGTAATAGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007487
VALIDATED
ARL4A MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 4A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007487.3-709s21c1
Sequence:CCGGATCATAGGAGATGGGCTAAAGCTCGAGCTTTAGCCCATCTCCTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007487.3-470s21c1
Sequence:CCGGCCCGATGCACAGATGGTATTGCTCGAGCAATACCATCTGTGCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007487.3-1264s21c1
Sequence:CCGGAGTTGAACACGCTGCGATAAGCTCGAGCTTATCGCAGCGTGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007487.3-320s21c1
Sequence:CCGGTGCAGTTCAACGAATTTGTAACTCGAGTTACAAATTCGTTGAACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007487.3-345s21c1
Sequence:CCGGCGTACCTACCAAAGGATTTAACTCGAGTTAAATCCTTTGGTAGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007487.2-305s1c1
Sequence:CCGGCGTACCTACCAAAGGATTTAACTCGAGTTAAATCCTTTGGTAGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007487.2-698s1c1
Sequence:CCGGCGAGAAACTACATGATATGATCTCGAGATCATATCATGTAGTTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007487.2-280s1c1
Sequence:CCGGTGCAGTTCAACGAATTTGTAACTCGAGTTACAAATTCGTTGAACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007487.2-543s1c1
Sequence:CCGGCCTGTGCTTATAGTTGCTAATCTCGAGATTAGCAACTATAAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007487.2-1518s1c1
Sequence:CCGGGCGCACTATTACTTGAACCTACTCGAGTAGGTTCAAGTAATAGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks