EMAIL THIS PAGE TO A FRIEND

ARL4C

ADP-ribosylation factor-like 4C

239 Gene Product Result for
Synonyms: ARL7 LAK
UniProtKB ID: P56559, Q53R10, Q9BVN1, Q9UQ34
Gene ID:
Human(10123) Summary: ADP-ribosylation factor-like 4C is a member of the ADP-ribosylation factor family of GTP-binding proteins. ARL4C is closely similar to ARL4A and ARL4D and each has a nuclear localization signal and an unusually high guanine nucleotide exchange rate. This protein may play a role in cholesterol transport. [provided by RefSeq, Jul 2008]
Mouse(320982) ADP-ribosylation factor-like 4C
Rat(367311) ADP-ribosylation factor-like 4C
chicken(424026) ADP-ribosylation factor-like 4C
domestic cat(101086414) ADP-ribosylation factor-like 4C
cow(788039) ADP-ribosylation factor-like 4C
dog(100685179) ADP-ribosylation factor-like 4C
sheep(100302312) ADP-ribosylation factor-like 4C
domestic guinea pig(100717758) ADP-ribosylation factor-like 4C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177305 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177305 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177305 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005737 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005737 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005737 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005737 Rosetta Predictions human pricing
XM_001057060 Rosetta Predictions rat pricing
XM_001065966 Rosetta Predictions rat pricing
NM_177305 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005737 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070512 predicted 458
2 SASI_Hs01_00070513 predicted 1182
3 SASI_Hs01_00070514 predicted 1486
4 SASI_Hs01_00070515 predicted 984
5 SASI_Hs01_00070516 predicted 1144
6 SASI_Hs01_00070517 predicted 902
7 SASI_Hs01_00070518 predicted 1389
8 SASI_Hs01_00070519 predicted 998
9 SASI_Hs01_00070520 predicted 545
10 SASI_Hs01_00070521 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057060 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285256 predicted 387
2 SASI_Rn02_00285257 predicted 438
3 SASI_Rn02_00285258 predicted 392
4 SASI_Rn02_00285259 predicted 427
5 SASI_Rn02_00285260 predicted 381
6 SASI_Rn02_00285261 predicted 432
7 SASI_Rn02_00285262 predicted 479
8 SASI_Rn02_00285263 predicted 421
9 SASI_Rn02_00285264 predicted 437
10 SASI_Rn02_00285265 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065966 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315934 predicted 1019
2 SASI_Rn02_00315935 predicted 936
3 SASI_Rn02_00315936 predicted 1008
4 SASI_Rn02_00315937 predicted 510
5 SASI_Rn02_00315938 predicted 656
6 SASI_Rn02_00315939 predicted 670
7 SASI_Rn02_00315940 predicted 526
8 SASI_Rn02_00315941 predicted 520
9 SASI_Rn02_00315942 predicted 688
10 SASI_Rn02_00315943 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177305 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139168 predicted 1047
2 SASI_Mm01_00139169 predicted 593
3 SASI_Mm01_00139170 predicted 827
4 SASI_Mm01_00139173 predicted 646
5 SASI_Mm01_00139174 predicted 1061
6 SASI_Mm02_00347379 predicted 856
7 SASI_Mm02_00347380 predicted 852
8 SASI_Mm02_00347381 predicted 787
9 SASI_Mm01_00139175 predicted 959
10 SASI_Mm01_00139176 predicted 934
11 SASI_Mm01_00139167 predicted 563
12 SASI_Mm01_00139171 predicted 641
13 SASI_Mm01_00139172 predicted 515
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177305
VALIDATED
ARL4C MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 4C
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177305.2-3100s1c1
Sequence:CCGGCCCTCCAATTTACTGGTCTTTCTCGAGAAAGACCAGTAAATTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177305.2-1002s1c1
Sequence:CCGGGCTCTATGAGATGATCCTGAACTCGAGTTCAGGATCATCTCATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177305.2-843s1c1
Sequence:CCGGGCTCCTGGTTATCGCCAACAACTCGAGTTGTTGGCGATAACCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177305.2-743s1c1
Sequence:CCGGGCATCATCTACGTGGTGGATTCTCGAGAATCCACCACGTAGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177305.2-627s1c1
Sequence:CCGGCGAGAAGATCAAACTGAGCAACTCGAGTTGCTCAGTTTGATCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177305.4-1049s21c1
Sequence:CCGGGCTCTATGAGATGATCCTGAACTCGAGTTCAGGATCATCTCATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177305.4-619s21c1
Sequence:CCGGACCGGCTCAAGTTCAACGAATCTCGAGATTCGTTGAACTTGAGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177305.4-1234s21c1
Sequence:CCGGACACGATCTCTGTATCCAAATCTCGAGATTTGGATACAGAGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177305.4-667s21c1
Sequence:CCGGTCAACACCGAGAAGATCAAACCTCGAGGTTTGATCTTCTCGGTGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177305.4-1067s21c1
Sequence:CCGGGAAACGCAGGAAGTCTCTCAACTCGAGTTGAGAGACTTCCTGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177305.4-1035s21c1
Sequence:CCGGGAGGGCATGGACAAGCTCTATCTCGAGATAGAGCTTGTCCATGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177305.4-1096s21c1
Sequence:GTACCGGAGAAGCGGTAATGCGCTAGAGCTCGAGCTCTAGCGCATTACCGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380301    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177305.4-1208s21c1
Sequence:GTACCGGCCAAAGCGATGATTCGAATTTCTCGAGAAATTCGAATCATCGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177305.4-857s21c1
Sequence:GTACCGGGGTGACCAAGTTTGCGGAGAACTCGAGTTCTCCGCAAACTTGGTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177305
VALIDATED
ARL4C MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 4C
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177305.2-3100s1c1
Sequence:CCGGCCCTCCAATTTACTGGTCTTTCTCGAGAAAGACCAGTAAATTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177305.2-1002s1c1
Sequence:CCGGGCTCTATGAGATGATCCTGAACTCGAGTTCAGGATCATCTCATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177305.2-843s1c1
Sequence:CCGGGCTCCTGGTTATCGCCAACAACTCGAGTTGTTGGCGATAACCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177305.2-743s1c1
Sequence:CCGGGCATCATCTACGTGGTGGATTCTCGAGAATCCACCACGTAGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177305.2-627s1c1
Sequence:CCGGCGAGAAGATCAAACTGAGCAACTCGAGTTGCTCAGTTTGATCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177305.4-1049s21c1
Sequence:CCGGGCTCTATGAGATGATCCTGAACTCGAGTTCAGGATCATCTCATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177305.4-619s21c1
Sequence:CCGGACCGGCTCAAGTTCAACGAATCTCGAGATTCGTTGAACTTGAGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177305.4-1234s21c1
Sequence:CCGGACACGATCTCTGTATCCAAATCTCGAGATTTGGATACAGAGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177305.4-667s21c1
Sequence:CCGGTCAACACCGAGAAGATCAAACCTCGAGGTTTGATCTTCTCGGTGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177305.4-1067s21c1
Sequence:CCGGGAAACGCAGGAAGTCTCTCAACTCGAGTTGAGAGACTTCCTGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177305.4-1035s21c1
Sequence:CCGGGAGGGCATGGACAAGCTCTATCTCGAGATAGAGCTTGTCCATGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177305.4-1096s21c1
Sequence:GTACCGGAGAAGCGGTAATGCGCTAGAGCTCGAGCTCTAGCGCATTACCGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380301    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177305.4-1208s21c1
Sequence:GTACCGGCCAAAGCGATGATTCGAATTTCTCGAGAAATTCGAATCATCGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177305.4-857s21c1
Sequence:GTACCGGGGTGACCAAGTTTGCGGAGAACTCGAGTTCTCCGCAAACTTGGTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177305
VALIDATED
ARL4C MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 4C
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177305.2-3100s1c1
Sequence:CCGGCCCTCCAATTTACTGGTCTTTCTCGAGAAAGACCAGTAAATTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177305.2-1002s1c1
Sequence:CCGGGCTCTATGAGATGATCCTGAACTCGAGTTCAGGATCATCTCATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177305.2-843s1c1
Sequence:CCGGGCTCCTGGTTATCGCCAACAACTCGAGTTGTTGGCGATAACCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177305.2-743s1c1
Sequence:CCGGGCATCATCTACGTGGTGGATTCTCGAGAATCCACCACGTAGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177305.2-627s1c1
Sequence:CCGGCGAGAAGATCAAACTGAGCAACTCGAGTTGCTCAGTTTGATCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177305.4-1049s21c1
Sequence:CCGGGCTCTATGAGATGATCCTGAACTCGAGTTCAGGATCATCTCATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177305.4-619s21c1
Sequence:CCGGACCGGCTCAAGTTCAACGAATCTCGAGATTCGTTGAACTTGAGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177305.4-1234s21c1
Sequence:CCGGACACGATCTCTGTATCCAAATCTCGAGATTTGGATACAGAGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177305.4-667s21c1
Sequence:CCGGTCAACACCGAGAAGATCAAACCTCGAGGTTTGATCTTCTCGGTGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177305.4-1067s21c1
Sequence:CCGGGAAACGCAGGAAGTCTCTCAACTCGAGTTGAGAGACTTCCTGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177305.4-1035s21c1
Sequence:CCGGGAGGGCATGGACAAGCTCTATCTCGAGATAGAGCTTGTCCATGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177305.4-1096s21c1
Sequence:GTACCGGAGAAGCGGTAATGCGCTAGAGCTCGAGCTCTAGCGCATTACCGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380301    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177305.4-1208s21c1
Sequence:GTACCGGCCAAAGCGATGATTCGAATTTCTCGAGAAATTCGAATCATCGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177305.4-857s21c1
Sequence:GTACCGGGGTGACCAAGTTTGCGGAGAACTCGAGTTCTCCGCAAACTTGGTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005737
VALIDATED
ARL4C MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 4C
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005737.3-970s1c1
Sequence:CCGGCGAGGGCATGGACAAGCTCTACTCGAGTAGAGCTTGTCCATGCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005737.3-559s1c1
Sequence:CCGGGCTCAAGTTCAACGAGTTCGTCTCGAGACGAACTCGTTGAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005737.3-994s1c1
Sequence:CCGGGATGATCCTGAAACGCAGGAACTCGAGTTCCTGCGTTTCAGGATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005737.3-499s1c1
Sequence:CCGGGTCCCTGCATATCGTCATGTTCTCGAGAACATGACGATATGCAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005737.3-505s1c1
Sequence:CCGGGCATATCGTCATGTTGGGCTTCTCGAGAAGCCCAACATGACGATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005737.3-1189s21c1
Sequence:GTACCGGACGGAATCTCTGCACCCAAATCTCGAGATTTGGGTGCAGAGATTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005737.3-1228s21c1
Sequence:GTACCGGGGAGCTGCGAAGTCTGATTTACTCGAGTAAATCAGACTTCGCAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005737.3-595s21c1
Sequence:CCGGCATCGGCTTCAACACCGAGAACTCGAGTTCTCGGTGTTGAAGCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005737.3-868s21c1
Sequence:GTACCGGGCCGGTGGCAGAGATTGAGAACTCGAGTTCTCAATCTCTGCCACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005737.3-994s21c1
Sequence:CCGGGATGATCCTGAAACGCAGGAACTCGAGTTCCTGCGTTTCAGGATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005737.3-499s21c1
Sequence:CCGGGTCCCTGCATATCGTCATGTTCTCGAGAACATGACGATATGCAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005737.3-559s21c1
Sequence:CCGGGCTCAAGTTCAACGAGTTCGTCTCGAGACGAACTCGTTGAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005737.3-1163s21c1
Sequence:CCGGCCAAAGCGATGCTTCGAATTTCTCGAGAAATTCGAAGCATCGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005737.3-727s21c1
Sequence:GTACCGGCATCATCTACGTGGTGGACTCCTCGAGGAGTCCACCACGTAGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005737.3-971s21c1
Sequence:GTACCGGGAGGGCATGGACAAGCTCTATCTCGAGATAGAGCTTGTCCATGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005737
VALIDATED
ARL4C MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 4C
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005737.3-970s1c1
Sequence:CCGGCGAGGGCATGGACAAGCTCTACTCGAGTAGAGCTTGTCCATGCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005737.3-559s1c1
Sequence:CCGGGCTCAAGTTCAACGAGTTCGTCTCGAGACGAACTCGTTGAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005737.3-994s1c1
Sequence:CCGGGATGATCCTGAAACGCAGGAACTCGAGTTCCTGCGTTTCAGGATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005737.3-499s1c1
Sequence:CCGGGTCCCTGCATATCGTCATGTTCTCGAGAACATGACGATATGCAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005737.3-505s1c1
Sequence:CCGGGCATATCGTCATGTTGGGCTTCTCGAGAAGCCCAACATGACGATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005737.3-1189s21c1
Sequence:GTACCGGACGGAATCTCTGCACCCAAATCTCGAGATTTGGGTGCAGAGATTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005737.3-1228s21c1
Sequence:GTACCGGGGAGCTGCGAAGTCTGATTTACTCGAGTAAATCAGACTTCGCAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005737.3-595s21c1
Sequence:CCGGCATCGGCTTCAACACCGAGAACTCGAGTTCTCGGTGTTGAAGCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005737.3-868s21c1
Sequence:GTACCGGGCCGGTGGCAGAGATTGAGAACTCGAGTTCTCAATCTCTGCCACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005737.3-994s21c1
Sequence:CCGGGATGATCCTGAAACGCAGGAACTCGAGTTCCTGCGTTTCAGGATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005737.3-499s21c1
Sequence:CCGGGTCCCTGCATATCGTCATGTTCTCGAGAACATGACGATATGCAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005737.3-559s21c1
Sequence:CCGGGCTCAAGTTCAACGAGTTCGTCTCGAGACGAACTCGTTGAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005737.3-1163s21c1
Sequence:CCGGCCAAAGCGATGCTTCGAATTTCTCGAGAAATTCGAAGCATCGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005737.3-727s21c1
Sequence:GTACCGGCATCATCTACGTGGTGGACTCCTCGAGGAGTCCACCACGTAGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005737.3-971s21c1
Sequence:GTACCGGGAGGGCATGGACAAGCTCTATCTCGAGATAGAGCTTGTCCATGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005737
VALIDATED
ARL4C MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 4C
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005737.3-970s1c1
Sequence:CCGGCGAGGGCATGGACAAGCTCTACTCGAGTAGAGCTTGTCCATGCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005737.3-559s1c1
Sequence:CCGGGCTCAAGTTCAACGAGTTCGTCTCGAGACGAACTCGTTGAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005737.3-994s1c1
Sequence:CCGGGATGATCCTGAAACGCAGGAACTCGAGTTCCTGCGTTTCAGGATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005737.3-499s1c1
Sequence:CCGGGTCCCTGCATATCGTCATGTTCTCGAGAACATGACGATATGCAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005737.3-505s1c1
Sequence:CCGGGCATATCGTCATGTTGGGCTTCTCGAGAAGCCCAACATGACGATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005737.3-1189s21c1
Sequence:GTACCGGACGGAATCTCTGCACCCAAATCTCGAGATTTGGGTGCAGAGATTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005737.3-1228s21c1
Sequence:GTACCGGGGAGCTGCGAAGTCTGATTTACTCGAGTAAATCAGACTTCGCAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005737.3-595s21c1
Sequence:CCGGCATCGGCTTCAACACCGAGAACTCGAGTTCTCGGTGTTGAAGCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005737.3-868s21c1
Sequence:GTACCGGGCCGGTGGCAGAGATTGAGAACTCGAGTTCTCAATCTCTGCCACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005737.3-994s21c1
Sequence:CCGGGATGATCCTGAAACGCAGGAACTCGAGTTCCTGCGTTTCAGGATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005737.3-499s21c1
Sequence:CCGGGTCCCTGCATATCGTCATGTTCTCGAGAACATGACGATATGCAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005737.3-559s21c1
Sequence:CCGGGCTCAAGTTCAACGAGTTCGTCTCGAGACGAACTCGTTGAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005737.3-1163s21c1
Sequence:CCGGCCAAAGCGATGCTTCGAATTTCTCGAGAAATTCGAAGCATCGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005737.3-727s21c1
Sequence:GTACCGGCATCATCTACGTGGTGGACTCCTCGAGGAGTCCACCACGTAGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005737.3-971s21c1
Sequence:GTACCGGGAGGGCATGGACAAGCTCTATCTCGAGATAGAGCTTGTCCATGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks