EMAIL THIS PAGE TO A FRIEND

ARL4D

ADP-ribosylation factor-like 4D

106 Gene Product Result for
Synonyms: ARF4L ARL6
UniProtKB ID: P49703, B2RC59, D3DX43
Gene ID:
Human(379) Summary: ADP-ribosylation factor 4D is a member of the ADP-ribosylation factor family of GTP-binding proteins. ARL4D is closely similar to ARL4A and ARL4C and each has a nuclear localization signal and an unusually high guanine nucleotide exchange rate. This protein may play a role in membrane-associated intracellular trafficking. Mutations in this gene have been associated with Bardet-Biedl syndrome (BBS). [provided by RefSeq, Jul 2008]
Mouse(80981) ADP-ribosylation factor-like 4D
Rat(303559) ADP-ribosylation factor-like 4D
Zebrafish(323573) ADP-ribosylation factor-like 4D
dog(490950) ADP-ribosylation factor-like 4D
cow(538936) ADP-ribosylation factor-like 4D
domestic cat(101094388) ADP-ribosylation factor-like 4D
domestic guinea pig(100722529) ADP-ribosylation factor-like 4D
sheep(101109813) ADP-ribosylation factor-like 4D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001661 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001661 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001661 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025404 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025404 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025404 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031160 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031160 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031160 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001661 Rosetta Predictions human pricing
NM_001107052 Rosetta Predictions rat pricing
NM_025404 Rosetta Predictions mouse pricing
NM_031160 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097157 predicted 1018
2 SASI_Hs01_00097159 predicted 980
3 SASI_Hs01_00097161 predicted 1132
4 SASI_Hs01_00097165 predicted 377
5 SASI_Hs02_00332268 predicted 965
6 SASI_Hs02_00332269 predicted 1265
7 SASI_Hs02_00332270 predicted 1008
8 SASI_Hs01_00097156 predicted 433
9 SASI_Hs01_00097158 predicted 950
10 SASI_Hs02_00332271 predicted 1035
11 SASI_Hs01_00097160 predicted 289
12 SASI_Hs01_00097162 predicted 967
13 SASI_Hs01_00097163 predicted 1017
14 SASI_Hs01_00097164 predicted 731
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107052 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225016 predicted 986
2 SASI_Rn02_00225017 predicted 728
3 SASI_Rn02_00225018 predicted 213
4 SASI_Rn02_00225019 predicted 496
5 SASI_Rn02_00225020 predicted 283
6 SASI_Rn02_00225021 predicted 451
7 SASI_Rn02_00225022 predicted 202
8 SASI_Rn02_00225023 predicted 431
9 SASI_Rn02_00225024 predicted 439
10 SASI_Rn02_00225025 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025404 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139118 predicted 946
2 SASI_Mm01_00139117 predicted 727
3 SASI_Mm01_00139119 predicted 517
4 SASI_Mm01_00139120 predicted 350
5 SASI_Mm01_00139121 predicted 349
6 SASI_Mm01_00139122 predicted 307
7 SASI_Mm01_00139123 predicted 477
8 SASI_Mm01_00139124 predicted 1003
9 SASI_Mm01_00139125 predicted 1009
10 SASI_Mm01_00139126 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031160 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042155 predicted 696
2 SASI_Mm01_00042156 predicted 1010
3 SASI_Mm01_00042157 predicted 435
4 SASI_Mm01_00042158 predicted 921
5 SASI_Mm01_00042159 predicted 407
6 SASI_Mm01_00042160 predicted 955
7 SASI_Mm01_00042161 predicted 443
8 SASI_Mm01_00042162 predicted 487
9 SASI_Mm01_00042163 predicted 425
10 SASI_Mm01_00042164 predicted 304
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001661
VALIDATED
ARL4D MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 4D
Human
20 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001661.3-1137s21c1
Sequence:GTACCGGAGAATGTGTTTGGGATGAAATCTCGAGATTTCATCCCAAACACATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001661.3-660s21c1
Sequence:GTACCGGCCACTCTCACTCATGTGCAAGCTCGAGCTTGCACATGAGTGAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001661.3-310s21c1
Sequence:GTACCGGCAAGGAGTTTGTCCAGAGTGTCTCGAGACACTCTGGACAAACTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001661.3-967s21c1
Sequence:GTACCGGGGATGTCTTTGCATATCTCTCCTCGAGGAGAGATATGCAAAGACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001661.3-1015s21c1
Sequence:CCGGCAGGACTGTGGAGACGTAAATCTCGAGATTTACGTCTCCACAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001661.3-720s21c1
Sequence:CCGGTTGAGCGCCTCTATGAGATGACTCGAGTCATCTCATAGAGGCGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001661.3-519s21c1
Sequence:CCGGAGGTGGAGTTGCACCGAATCACTCGAGTGATTCGGTGCAACTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001661.3-459s21c1
Sequence:CCGGGGACAGACGGTCTAGTGTTTGCTCGAGCAAACACTAGACCGTCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001661.3-432s21c1
Sequence:CCGGGACCACTGTGGCGCTCTTATACTCGAGTATAAGAGCGCCACAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001661.3-772s21c1
Sequence:GTACCGGCAAGAAGAGACGGTGACCCAACTCGAGTTGGGTCACCGTCTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001661.3-385s21c1
Sequence:GTACCGGTGGCATCACCTTCCAAGTGTGCTCGAGCACACTTGGAAGGTGATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001661.3-1046s21c1
Sequence:GTACCGGACTCTACCTCGACCCTGTTTCCTCGAGGAAACAGGGTCGAGGTAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001661.3-471s21c1
Sequence:GTACCGGTAGTGTTTGTGGTGGACGCTGCTCGAGCAGCGTCCACCACAAACACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001661.3-887s21c1
Sequence:GTACCGGGGACCTGTCCACCTCAATGAACTCGAGTTCATTGAGGTGGACAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001661.3-302s21c1
Sequence:GTACCGGCTCAAGTTCAAGGAGTTTGTCCTCGAGGACAAACTCCTTGAACTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001661.2-331s1c1
Sequence:CCGGCAAAGGCTTCAACACCGAGAACTCGAGTTCTCGGTGTTGAAGCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001661.2-425s1c1
Sequence:CCGGCGACCACTGTGGCGCTCTTATCTCGAGATAAGAGCGCCACAGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001661.2-653s1c1
Sequence:CCGGGCCACTCTCACTCATGTGCAACTCGAGTTGCACATGAGTGAGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001661.2-293s1c1
Sequence:CCGGCGCCTCAAGTTCAAGGAGTTTCTCGAGAAACTCCTTGAACTTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001661.2-715s1c1
Sequence:CCGGTGAGCGCCTCTATGAGATGATCTCGAGATCATCTCATAGAGGCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001661
VALIDATED
ARL4D MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 4D
Human
20 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001661.3-1137s21c1
Sequence:GTACCGGAGAATGTGTTTGGGATGAAATCTCGAGATTTCATCCCAAACACATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001661.3-660s21c1
Sequence:GTACCGGCCACTCTCACTCATGTGCAAGCTCGAGCTTGCACATGAGTGAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001661.3-310s21c1
Sequence:GTACCGGCAAGGAGTTTGTCCAGAGTGTCTCGAGACACTCTGGACAAACTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001661.3-967s21c1
Sequence:GTACCGGGGATGTCTTTGCATATCTCTCCTCGAGGAGAGATATGCAAAGACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001661.3-1015s21c1
Sequence:CCGGCAGGACTGTGGAGACGTAAATCTCGAGATTTACGTCTCCACAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001661.3-720s21c1
Sequence:CCGGTTGAGCGCCTCTATGAGATGACTCGAGTCATCTCATAGAGGCGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001661.3-519s21c1
Sequence:CCGGAGGTGGAGTTGCACCGAATCACTCGAGTGATTCGGTGCAACTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001661.3-459s21c1
Sequence:CCGGGGACAGACGGTCTAGTGTTTGCTCGAGCAAACACTAGACCGTCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001661.3-432s21c1
Sequence:CCGGGACCACTGTGGCGCTCTTATACTCGAGTATAAGAGCGCCACAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001661.3-772s21c1
Sequence:GTACCGGCAAGAAGAGACGGTGACCCAACTCGAGTTGGGTCACCGTCTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001661.3-385s21c1
Sequence:GTACCGGTGGCATCACCTTCCAAGTGTGCTCGAGCACACTTGGAAGGTGATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001661.3-1046s21c1
Sequence:GTACCGGACTCTACCTCGACCCTGTTTCCTCGAGGAAACAGGGTCGAGGTAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001661.3-471s21c1
Sequence:GTACCGGTAGTGTTTGTGGTGGACGCTGCTCGAGCAGCGTCCACCACAAACACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001661.3-887s21c1
Sequence:GTACCGGGGACCTGTCCACCTCAATGAACTCGAGTTCATTGAGGTGGACAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001661.3-302s21c1
Sequence:GTACCGGCTCAAGTTCAAGGAGTTTGTCCTCGAGGACAAACTCCTTGAACTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001661.2-331s1c1
Sequence:CCGGCAAAGGCTTCAACACCGAGAACTCGAGTTCTCGGTGTTGAAGCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001661.2-425s1c1
Sequence:CCGGCGACCACTGTGGCGCTCTTATCTCGAGATAAGAGCGCCACAGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001661.2-653s1c1
Sequence:CCGGGCCACTCTCACTCATGTGCAACTCGAGTTGCACATGAGTGAGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001661.2-293s1c1
Sequence:CCGGCGCCTCAAGTTCAAGGAGTTTCTCGAGAAACTCCTTGAACTTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001661.2-715s1c1
Sequence:CCGGTGAGCGCCTCTATGAGATGATCTCGAGATCATCTCATAGAGGCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001661
VALIDATED
ARL4D MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 4D
Human
20 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001661.3-1137s21c1
Sequence:GTACCGGAGAATGTGTTTGGGATGAAATCTCGAGATTTCATCCCAAACACATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001661.3-660s21c1
Sequence:GTACCGGCCACTCTCACTCATGTGCAAGCTCGAGCTTGCACATGAGTGAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001661.3-310s21c1
Sequence:GTACCGGCAAGGAGTTTGTCCAGAGTGTCTCGAGACACTCTGGACAAACTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001661.3-967s21c1
Sequence:GTACCGGGGATGTCTTTGCATATCTCTCCTCGAGGAGAGATATGCAAAGACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001661.3-1015s21c1
Sequence:CCGGCAGGACTGTGGAGACGTAAATCTCGAGATTTACGTCTCCACAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001661.3-720s21c1
Sequence:CCGGTTGAGCGCCTCTATGAGATGACTCGAGTCATCTCATAGAGGCGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001661.3-519s21c1
Sequence:CCGGAGGTGGAGTTGCACCGAATCACTCGAGTGATTCGGTGCAACTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001661.3-459s21c1
Sequence:CCGGGGACAGACGGTCTAGTGTTTGCTCGAGCAAACACTAGACCGTCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001661.3-432s21c1
Sequence:CCGGGACCACTGTGGCGCTCTTATACTCGAGTATAAGAGCGCCACAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001661.3-772s21c1
Sequence:GTACCGGCAAGAAGAGACGGTGACCCAACTCGAGTTGGGTCACCGTCTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001661.3-385s21c1
Sequence:GTACCGGTGGCATCACCTTCCAAGTGTGCTCGAGCACACTTGGAAGGTGATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001661.3-1046s21c1
Sequence:GTACCGGACTCTACCTCGACCCTGTTTCCTCGAGGAAACAGGGTCGAGGTAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001661.3-471s21c1
Sequence:GTACCGGTAGTGTTTGTGGTGGACGCTGCTCGAGCAGCGTCCACCACAAACACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001661.3-887s21c1
Sequence:GTACCGGGGACCTGTCCACCTCAATGAACTCGAGTTCATTGAGGTGGACAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001661.3-302s21c1
Sequence:GTACCGGCTCAAGTTCAAGGAGTTTGTCCTCGAGGACAAACTCCTTGAACTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001661.2-331s1c1
Sequence:CCGGCAAAGGCTTCAACACCGAGAACTCGAGTTCTCGGTGTTGAAGCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001661.2-425s1c1
Sequence:CCGGCGACCACTGTGGCGCTCTTATCTCGAGATAAGAGCGCCACAGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001661.2-653s1c1
Sequence:CCGGGCCACTCTCACTCATGTGCAACTCGAGTTGCACATGAGTGAGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001661.2-293s1c1
Sequence:CCGGCGCCTCAAGTTCAAGGAGTTTCTCGAGAAACTCCTTGAACTTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001661.2-715s1c1
Sequence:CCGGTGAGCGCCTCTATGAGATGATCTCGAGATCATCTCATAGAGGCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025404
ARL4D MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 4D
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025404.1-995s1c1
Sequence:CCGGCGGAGAAAGATGTAAATGCTACTCGAGTAGCATTTACATCTTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025404.1-516s1c1
Sequence:CCGGCAGAATGGAGTTACACCGGATCTCGAGATCCGGTGTAACTCCATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025404.1-298s1c1
Sequence:CCGGCGTCTCAAGTTCAAGGAGTTTCTCGAGAAACTCCTTGAACTTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025404.1-251s1c1
Sequence:CCGGTCGTCGTCATTGGGTTGGATTCTCGAGAATCCAACCCAATGACGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025404.1-717s1c1
Sequence:CCGGCCTGGAACATTTGTATGAAATCTCGAGATTTCATACAAATGTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025404
ARL4D MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 4D
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025404.1-995s1c1
Sequence:CCGGCGGAGAAAGATGTAAATGCTACTCGAGTAGCATTTACATCTTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025404.1-516s1c1
Sequence:CCGGCAGAATGGAGTTACACCGGATCTCGAGATCCGGTGTAACTCCATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025404.1-298s1c1
Sequence:CCGGCGTCTCAAGTTCAAGGAGTTTCTCGAGAAACTCCTTGAACTTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025404.1-251s1c1
Sequence:CCGGTCGTCGTCATTGGGTTGGATTCTCGAGAATCCAACCCAATGACGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025404.1-717s1c1
Sequence:CCGGCCTGGAACATTTGTATGAAATCTCGAGATTTCATACAAATGTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025404
ARL4D MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 4D
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025404.1-995s1c1
Sequence:CCGGCGGAGAAAGATGTAAATGCTACTCGAGTAGCATTTACATCTTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025404.1-516s1c1
Sequence:CCGGCAGAATGGAGTTACACCGGATCTCGAGATCCGGTGTAACTCCATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025404.1-298s1c1
Sequence:CCGGCGTCTCAAGTTCAAGGAGTTTCTCGAGAAACTCCTTGAACTTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025404.1-251s1c1
Sequence:CCGGTCGTCGTCATTGGGTTGGATTCTCGAGAATCCAACCCAATGACGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025404.1-717s1c1
Sequence:CCGGCCTGGAACATTTGTATGAAATCTCGAGATTTCATACAAATGTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031160
ARL4D MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 4D
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031160.1-708s1c1
Sequence:CCGGTGAGATGATTCTCAAGAGGAACTCGAGTTCCTCTTGAGAATCATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031160.1-321s1c1
Sequence:CCGGCAACACTGAGAAGATCCGAGTCTCGAGACTCGGATCTTCTCAGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031160.1-474s1c1
Sequence:CCGGTGAAAGGTTAGAGGAGGCCAACTCGAGTTGGCCTCCTCTAACCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031160.1-697s1c1
Sequence:CCGGGAGCGCCTGTATGAGATGATTCTCGAGAATCATCTCATACAGGCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031160.1-1090s1c1
Sequence:CCGGGCATTTGGGATAAGCGGAGAACTCGAGTTCTCCGCTTATCCCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031160
ARL4D MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 4D
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031160.1-708s1c1
Sequence:CCGGTGAGATGATTCTCAAGAGGAACTCGAGTTCCTCTTGAGAATCATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031160.1-321s1c1
Sequence:CCGGCAACACTGAGAAGATCCGAGTCTCGAGACTCGGATCTTCTCAGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031160.1-474s1c1
Sequence:CCGGTGAAAGGTTAGAGGAGGCCAACTCGAGTTGGCCTCCTCTAACCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031160.1-697s1c1
Sequence:CCGGGAGCGCCTGTATGAGATGATTCTCGAGAATCATCTCATACAGGCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031160.1-1090s1c1
Sequence:CCGGGCATTTGGGATAAGCGGAGAACTCGAGTTCTCCGCTTATCCCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031160
ARL4D MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 4D
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031160.1-708s1c1
Sequence:CCGGTGAGATGATTCTCAAGAGGAACTCGAGTTCCTCTTGAGAATCATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031160.1-321s1c1
Sequence:CCGGCAACACTGAGAAGATCCGAGTCTCGAGACTCGGATCTTCTCAGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031160.1-474s1c1
Sequence:CCGGTGAAAGGTTAGAGGAGGCCAACTCGAGTTGGCCTCCTCTAACCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031160.1-697s1c1
Sequence:CCGGGAGCGCCTGTATGAGATGATTCTCGAGAATCATCTCATACAGGCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031160.1-1090s1c1
Sequence:CCGGGCATTTGGGATAAGCGGAGAACTCGAGTTCTCCGCTTATCCCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks