EMAIL THIS PAGE TO A FRIEND

ARL5B

ADP-ribosylation factor-like 5B

183 Gene Product Result for
Synonyms: ARL8
UniProtKB ID: Q96KC2
Gene ID:
Human(221079) Summary: ARL5B (ARL8) belongs to a family of proteins that are structurally similar to ADP-ribosylation factors (ARFs; see MIM 103180). ARLs and ARFs are part of the RAS superfamily of regulatory GTPases.[supplied by OMIM, Nov 2010]
Mouse(75869) ADP-ribosylation factor-like 5B
Rat(364788) ADP-ribosylation factor-like 5B
chicken(420513) ADP-ribosylation factor-like 5B
dog(606791) ADP-ribosylation factor-like 5B
cow(616679) ADP-ribosylation factor-like 5B
domestic cat(101101479) ADP-ribosylation factor-like 5B
naked mole-rat(101713041) ADP-ribosylation factor-like 5B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029466 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029466 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029466 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178815 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178815 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178815 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178815 Rosetta Predictions human pricing
NM_001015031 Rosetta Predictions rat pricing
NM_029466 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237510 predicted 583
2 SASI_Hs01_00237511 predicted 500
3 SASI_Hs01_00237512 predicted 693
4 SASI_Hs01_00237513 predicted 288
5 SASI_Hs01_00237514 predicted 482
6 SASI_Hs01_00237515 predicted 295
7 SASI_Hs01_00237516 predicted 495
8 SASI_Hs01_00237517 predicted 572
9 SASI_Hs01_00237518 predicted 485
10 SASI_Hs02_00369855 predicted 256
11 SASI_Hs01_00237509 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015031 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202147 predicted 942
2 SASI_Rn02_00202148 predicted 426
3 SASI_Rn02_00202149 predicted 484
4 SASI_Rn02_00202150 predicted 233
5 SASI_Rn02_00202151 predicted 576
6 SASI_Rn02_00202152 predicted 824
7 SASI_Rn02_00202153 predicted 375
8 SASI_Rn02_00202154 predicted 857
9 SASI_Rn02_00202155 predicted 977
10 SASI_Rn02_00202156 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029466 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064656 predicted 259
2 SASI_Mm01_00064657 predicted 469
3 SASI_Mm02_00335395 predicted 266
4 SASI_Mm01_00064658 predicted 259
5 SASI_Mm01_00064660 predicted 308
6 SASI_Mm01_00064661 predicted 565
7 SASI_Mm01_00064662 predicted 400
8 SASI_Mm01_00064664 predicted 400
9 SASI_Mm01_00064665 predicted 503
10 SASI_Mm02_00335396 predicted 544
11 SASI_Mm01_00064659 predicted 336
12 SASI_Mm01_00064663 predicted 494
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029466
VALIDATED
ARL5B MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 5B
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029466.4-366s21c1
Sequence:CCGGATCGGTGGTCAAGAATCTCTGCTCGAGCAGAGATTCTTGACCACCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029466.4-274s21c1
Sequence:CCGGTCTTAATGAATGAAGTAGTTCCTCGAGGAACTACTTCATTCATTAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029466.4-332s21c1
Sequence:CCGGCGTTGTGAAGAACACTCATTTCTCGAGAAATGAGTGTTCTTCACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029466.4-493s21c1
Sequence:CCGGTGTTGGCCCATGAGGATTTAACTCGAGTTAAATCCTCATGGGCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029466.4-1059s21c1
Sequence:CCGGACCATGCTCTTTCCGAGATACCTCGAGGTATCTCGGAAAGAGCATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029466.4-389s21c1
Sequence:CCGGGTCATCCTGGAACACCTATTACTCGAGTAATAGGTGTTCCAGGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029466.4-206s21c1
Sequence:CCGGTAACCAAGAGCACAAAGTAATCTCGAGATTACTTTGTGCTCTTGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029466.2-2118s1c1
Sequence:CCGGGCAGTGTTAATGGTTCCCAAACTCGAGTTTGGGAACCATTAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029466.2-429s1c1
Sequence:CCGGCATTCTTGTTGTGGATAGCATCTCGAGATGCTATCCACAACAAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029466.2-591s1c1
Sequence:CCGGCCTCACCCTAAGTTCAATCAACTCGAGTTGATTGAACTTAGGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029466.2-460s1c1
Sequence:CCGGCGCCTGGCTATTACGAAAGAACTCGAGTTCTTTCGTAATAGCCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029466.2-499s1c1
Sequence:CCGGGCCCATGAGGATTTAAGGAAACTCGAGTTTCCTTAAATCCTCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029466
VALIDATED
ARL5B MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 5B
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029466.4-366s21c1
Sequence:CCGGATCGGTGGTCAAGAATCTCTGCTCGAGCAGAGATTCTTGACCACCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029466.4-274s21c1
Sequence:CCGGTCTTAATGAATGAAGTAGTTCCTCGAGGAACTACTTCATTCATTAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029466.4-332s21c1
Sequence:CCGGCGTTGTGAAGAACACTCATTTCTCGAGAAATGAGTGTTCTTCACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029466.4-493s21c1
Sequence:CCGGTGTTGGCCCATGAGGATTTAACTCGAGTTAAATCCTCATGGGCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029466.4-1059s21c1
Sequence:CCGGACCATGCTCTTTCCGAGATACCTCGAGGTATCTCGGAAAGAGCATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029466.4-389s21c1
Sequence:CCGGGTCATCCTGGAACACCTATTACTCGAGTAATAGGTGTTCCAGGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029466.4-206s21c1
Sequence:CCGGTAACCAAGAGCACAAAGTAATCTCGAGATTACTTTGTGCTCTTGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029466.2-2118s1c1
Sequence:CCGGGCAGTGTTAATGGTTCCCAAACTCGAGTTTGGGAACCATTAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029466.2-429s1c1
Sequence:CCGGCATTCTTGTTGTGGATAGCATCTCGAGATGCTATCCACAACAAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029466.2-591s1c1
Sequence:CCGGCCTCACCCTAAGTTCAATCAACTCGAGTTGATTGAACTTAGGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029466.2-460s1c1
Sequence:CCGGCGCCTGGCTATTACGAAAGAACTCGAGTTCTTTCGTAATAGCCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029466.2-499s1c1
Sequence:CCGGGCCCATGAGGATTTAAGGAAACTCGAGTTTCCTTAAATCCTCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029466
VALIDATED
ARL5B MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 5B
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029466.4-366s21c1
Sequence:CCGGATCGGTGGTCAAGAATCTCTGCTCGAGCAGAGATTCTTGACCACCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029466.4-274s21c1
Sequence:CCGGTCTTAATGAATGAAGTAGTTCCTCGAGGAACTACTTCATTCATTAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029466.4-332s21c1
Sequence:CCGGCGTTGTGAAGAACACTCATTTCTCGAGAAATGAGTGTTCTTCACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029466.4-493s21c1
Sequence:CCGGTGTTGGCCCATGAGGATTTAACTCGAGTTAAATCCTCATGGGCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029466.4-1059s21c1
Sequence:CCGGACCATGCTCTTTCCGAGATACCTCGAGGTATCTCGGAAAGAGCATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029466.4-389s21c1
Sequence:CCGGGTCATCCTGGAACACCTATTACTCGAGTAATAGGTGTTCCAGGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029466.4-206s21c1
Sequence:CCGGTAACCAAGAGCACAAAGTAATCTCGAGATTACTTTGTGCTCTTGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029466.2-2118s1c1
Sequence:CCGGGCAGTGTTAATGGTTCCCAAACTCGAGTTTGGGAACCATTAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029466.2-429s1c1
Sequence:CCGGCATTCTTGTTGTGGATAGCATCTCGAGATGCTATCCACAACAAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029466.2-591s1c1
Sequence:CCGGCCTCACCCTAAGTTCAATCAACTCGAGTTGATTGAACTTAGGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029466.2-460s1c1
Sequence:CCGGCGCCTGGCTATTACGAAAGAACTCGAGTTCTTTCGTAATAGCCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029466.2-499s1c1
Sequence:CCGGGCCCATGAGGATTTAAGGAAACTCGAGTTTCCTTAAATCCTCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178815
VALIDATED
ARL5B MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 5B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178815.3-313s21c1
Sequence:CCGGTTATAGTGGGACTGGATAATGCTCGAGCATTATCCAGTCCCACTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178815.3-538s21c1
Sequence:CCGGACAGGGAACGACTAGCTATTACTCGAGTAATAGCTAGTCGTTCCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178815.3-361s21c1
Sequence:CCGGTCTTAATGAATGAAGTGGTTCCTCGAGGAACCACTTCATTCATTAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178815.3-419s21c1
Sequence:CCGGAGTTGTGAAGAACACTCATTTCTCGAGAAATGAGTGTTCTTCACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178815.3-579s21c1
Sequence:CCGGATGTTGGCTCATGAGGATTTACTCGAGTAAATCCTCATGAGCCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178815.2-657s1c1
Sequence:CCGGCCTCACCCTTAGTTCAATTAACTCGAGTTAATTGAACTAAGGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178815.2-272s1c1
Sequence:CCGGGTAACCAAGAACACAAAGTAACTCGAGTTACTTTGTGTTCTTGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178815.2-370s1c1
Sequence:CCGGCCAACCATAGGAAGCAATGTTCTCGAGAACATTGCTTCCTATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178815.2-589s1c1
Sequence:CCGGGCAGTCCTTATCTTTGCAAATCTCGAGATTTGCAAAGATAAGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178815.2-453s1c1
Sequence:CCGGGCGATCATCCTGGAACACATACTCGAGTATGTGTTCCAGGATGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178815
VALIDATED
ARL5B MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 5B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178815.3-313s21c1
Sequence:CCGGTTATAGTGGGACTGGATAATGCTCGAGCATTATCCAGTCCCACTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178815.3-538s21c1
Sequence:CCGGACAGGGAACGACTAGCTATTACTCGAGTAATAGCTAGTCGTTCCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178815.3-361s21c1
Sequence:CCGGTCTTAATGAATGAAGTGGTTCCTCGAGGAACCACTTCATTCATTAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178815.3-419s21c1
Sequence:CCGGAGTTGTGAAGAACACTCATTTCTCGAGAAATGAGTGTTCTTCACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178815.3-579s21c1
Sequence:CCGGATGTTGGCTCATGAGGATTTACTCGAGTAAATCCTCATGAGCCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178815.2-657s1c1
Sequence:CCGGCCTCACCCTTAGTTCAATTAACTCGAGTTAATTGAACTAAGGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178815.2-272s1c1
Sequence:CCGGGTAACCAAGAACACAAAGTAACTCGAGTTACTTTGTGTTCTTGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178815.2-370s1c1
Sequence:CCGGCCAACCATAGGAAGCAATGTTCTCGAGAACATTGCTTCCTATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178815.2-589s1c1
Sequence:CCGGGCAGTCCTTATCTTTGCAAATCTCGAGATTTGCAAAGATAAGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178815.2-453s1c1
Sequence:CCGGGCGATCATCCTGGAACACATACTCGAGTATGTGTTCCAGGATGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178815
VALIDATED
ARL5B MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 5B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178815.3-313s21c1
Sequence:CCGGTTATAGTGGGACTGGATAATGCTCGAGCATTATCCAGTCCCACTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178815.3-538s21c1
Sequence:CCGGACAGGGAACGACTAGCTATTACTCGAGTAATAGCTAGTCGTTCCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178815.3-361s21c1
Sequence:CCGGTCTTAATGAATGAAGTGGTTCCTCGAGGAACCACTTCATTCATTAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178815.3-419s21c1
Sequence:CCGGAGTTGTGAAGAACACTCATTTCTCGAGAAATGAGTGTTCTTCACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178815.3-579s21c1
Sequence:CCGGATGTTGGCTCATGAGGATTTACTCGAGTAAATCCTCATGAGCCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178815.2-657s1c1
Sequence:CCGGCCTCACCCTTAGTTCAATTAACTCGAGTTAATTGAACTAAGGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178815.2-272s1c1
Sequence:CCGGGTAACCAAGAACACAAAGTAACTCGAGTTACTTTGTGTTCTTGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178815.2-370s1c1
Sequence:CCGGCCAACCATAGGAAGCAATGTTCTCGAGAACATTGCTTCCTATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178815.2-589s1c1
Sequence:CCGGGCAGTCCTTATCTTTGCAAATCTCGAGATTTGCAAAGATAAGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178815.2-453s1c1
Sequence:CCGGGCGATCATCCTGGAACACATACTCGAGTATGTGTTCCAGGATGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks