EMAIL THIS PAGE TO A FRIEND

ARL5C

ADP-ribosylation factor-like 5C

42 Gene Product Result for
Synonyms: ARL12
UniProtKB ID: A6NH57
Gene ID:
Mouse(217151) ADP-ribosylation factor-like 5C
Rat(497990) ADP-ribosylation factor-like 5C
Zebrafish(393819) ADP-ribosylation factor-like 5C
dog(608600) ADP-ribosylation factor-like protein 5C-like
sheep(100302314) ADP-ribosylation factor-like 5C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_147612 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_147612 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_147612 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_207231 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207231 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207231 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001143968 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001143968 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001143968 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU053621 MISSION® esiRNA esiRNA targeting mouse Arl5c (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_372668 Rosetta Predictions human pricing
NM_001109046 Rosetta Predictions rat pricing
NM_207231 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372668 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265535 predicted 116
2 SASI_Hs01_00265536 predicted 112
3 SASI_Hs01_00265537 predicted 88
4 SASI_Hs01_00265538 predicted 105
5 SASI_Hs01_00265539 predicted 82
6 SASI_Hs01_00265540 predicted 18
7 SASI_Hs01_00265541 predicted 78
8 SASI_Hs01_00265542 predicted 63
9 SASI_Hs01_00265543 predicted 92
10 SASI_Hs01_00265544 predicted 112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109046 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244594 predicted 434
2 SASI_Rn02_00244595 predicted 639
3 SASI_Rn02_00244596 predicted 198
4 SASI_Rn02_00244597 predicted 633
5 SASI_Rn02_00244598 predicted 246
6 SASI_Rn02_00244599 predicted 649
7 SASI_Rn02_00244600 predicted 282
8 SASI_Rn02_00244601 predicted 491
9 SASI_Rn02_00244602 predicted 290
10 SASI_Rn02_00244603 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207231 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351948 predicted 666
2 SASI_Mm01_00157917 predicted 538
3 SASI_Mm01_00157918 predicted 1190
4 SASI_Mm01_00157920 predicted 673
5 SASI_Mm01_00157921 predicted 485
6 SASI_Mm01_00157922 predicted 709
7 SASI_Mm01_00157923 predicted 749
8 SASI_Mm01_00157924 predicted 542
9 SASI_Mm01_00157925 predicted 1060
10 SASI_Mm02_00351949 predicted 1242
11 SASI_Mm01_00157916 predicted 467
12 SASI_Mm01_00157919 predicted 990
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_147612
ARL5C MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 5C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100780    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_147612.3-899s1c1
Sequence:CCGGCCAGTGAGAAACACCAGTCATCTCGAGATGACTGGTGTTTCTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_147612.3-547s1c1
Sequence:CCGGTGGGACACTTACTACTCTAATCTCGAGATTAGAGTAGTAAGTGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_147612.3-545s1c1
Sequence:CCGGCCTGGGACACTTACTACTCTACTCGAGTAGAGTAGTAAGTGTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_147612.3-582s1c1
Sequence:CCGGCCTTGTGATAGATAGCACAGACTCGAGTCTGTGCTATCTATCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_147612.3-688s1c1
Sequence:CCGGGCCAACAAGCAGGATGTGAAACTCGAGTTTCACATCCTGCTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_147612
ARL5C MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 5C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100780    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_147612.3-899s1c1
Sequence:CCGGCCAGTGAGAAACACCAGTCATCTCGAGATGACTGGTGTTTCTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_147612.3-547s1c1
Sequence:CCGGTGGGACACTTACTACTCTAATCTCGAGATTAGAGTAGTAAGTGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_147612.3-545s1c1
Sequence:CCGGCCTGGGACACTTACTACTCTACTCGAGTAGAGTAGTAAGTGTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_147612.3-582s1c1
Sequence:CCGGCCTTGTGATAGATAGCACAGACTCGAGTCTGTGCTATCTATCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_147612.3-688s1c1
Sequence:CCGGGCCAACAAGCAGGATGTGAAACTCGAGTTTCACATCCTGCTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_147612
ARL5C MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 5C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100780    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_147612.3-899s1c1
Sequence:CCGGCCAGTGAGAAACACCAGTCATCTCGAGATGACTGGTGTTTCTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_147612.3-547s1c1
Sequence:CCGGTGGGACACTTACTACTCTAATCTCGAGATTAGAGTAGTAAGTGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_147612.3-545s1c1
Sequence:CCGGCCTGGGACACTTACTACTCTACTCGAGTAGAGTAGTAAGTGTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_147612.3-582s1c1
Sequence:CCGGCCTTGTGATAGATAGCACAGACTCGAGTCTGTGCTATCTATCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_147612.3-688s1c1
Sequence:CCGGGCCAACAAGCAGGATGTGAAACTCGAGTTTCACATCCTGCTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207231
ARL5C MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 5C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207231.1-568s21c1
Sequence:GTACCGGTGTCATCCTTGTGATAGATAGCTCGAGCTATCTATCACAAGGATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207231.1-713s21c1
Sequence:GTACCGGACAGCAGAGATCTCCCAATTTCTCGAGAAATTGGGAGATCTCTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207231.1-1168s21c1
Sequence:GTACCGGGACGAAGGAGATTCCGATAAACTCGAGTTTATCGGAATCTCCTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207231.1-369s21c1
Sequence:GTACCGGTTATCGTGGGACTGGACAATGCTCGAGCATTGTCCAGTCCCACGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207231.1-1127s21c1
Sequence:GTACCGGTCGGCAAGCAAGAGATCTTTGCTCGAGCAAAGATCTCTTGCTTGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207231
ARL5C MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 5C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207231.1-568s21c1
Sequence:GTACCGGTGTCATCCTTGTGATAGATAGCTCGAGCTATCTATCACAAGGATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207231.1-713s21c1
Sequence:GTACCGGACAGCAGAGATCTCCCAATTTCTCGAGAAATTGGGAGATCTCTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207231.1-1168s21c1
Sequence:GTACCGGGACGAAGGAGATTCCGATAAACTCGAGTTTATCGGAATCTCCTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207231.1-369s21c1
Sequence:GTACCGGTTATCGTGGGACTGGACAATGCTCGAGCATTGTCCAGTCCCACGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207231.1-1127s21c1
Sequence:GTACCGGTCGGCAAGCAAGAGATCTTTGCTCGAGCAAAGATCTCTTGCTTGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207231
ARL5C MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 5C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207231.1-568s21c1
Sequence:GTACCGGTGTCATCCTTGTGATAGATAGCTCGAGCTATCTATCACAAGGATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207231.1-713s21c1
Sequence:GTACCGGACAGCAGAGATCTCCCAATTTCTCGAGAAATTGGGAGATCTCTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207231.1-1168s21c1
Sequence:GTACCGGGACGAAGGAGATTCCGATAAACTCGAGTTTATCGGAATCTCCTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207231.1-369s21c1
Sequence:GTACCGGTTATCGTGGGACTGGACAATGCTCGAGCATTGTCCAGTCCCACGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207231.1-1127s21c1
Sequence:GTACCGGTCGGCAAGCAAGAGATCTTTGCTCGAGCAAAGATCTCTTGCTTGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001143968
ARL5C MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 5C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143968.1-550s21c1
Sequence:CCGGGCAACGTGGAGGAGATCATTCCTCGAGGAATGATCTCCTCCACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143968.1-750s21c1
Sequence:CCGGGATGCTTCAGTCCTGATATTTCTCGAGAAATATCAGGACTGAAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143968.1-642s21c1
Sequence:CCGGTACTCCAACACTGAGTTTATCCTCGAGGATAAACTCAGTGTTGGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143968.1-460s21c1
Sequence:CCGGTCATCGTGGGACTGGACAATGCTCGAGCATTGTCCAGTCCCACGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143968.1-704s21c1
Sequence:CCGGCACTCGGGAGGAGCTATATAACTCGAGTTATATAGCTCCTCCCGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001143968
ARL5C MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 5C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143968.1-550s21c1
Sequence:CCGGGCAACGTGGAGGAGATCATTCCTCGAGGAATGATCTCCTCCACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143968.1-750s21c1
Sequence:CCGGGATGCTTCAGTCCTGATATTTCTCGAGAAATATCAGGACTGAAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143968.1-642s21c1
Sequence:CCGGTACTCCAACACTGAGTTTATCCTCGAGGATAAACTCAGTGTTGGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143968.1-460s21c1
Sequence:CCGGTCATCGTGGGACTGGACAATGCTCGAGCATTGTCCAGTCCCACGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143968.1-704s21c1
Sequence:CCGGCACTCGGGAGGAGCTATATAACTCGAGTTATATAGCTCCTCCCGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001143968
ARL5C MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 5C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143968.1-550s21c1
Sequence:CCGGGCAACGTGGAGGAGATCATTCCTCGAGGAATGATCTCCTCCACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143968.1-750s21c1
Sequence:CCGGGATGCTTCAGTCCTGATATTTCTCGAGAAATATCAGGACTGAAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143968.1-642s21c1
Sequence:CCGGTACTCCAACACTGAGTTTATCCTCGAGGATAAACTCAGTGTTGGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143968.1-460s21c1
Sequence:CCGGTCATCGTGGGACTGGACAATGCTCGAGCATTGTCCAGTCCCACGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143968.1-704s21c1
Sequence:CCGGCACTCGGGAGGAGCTATATAACTCGAGTTATATAGCTCCTCCCGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks