EMAIL THIS PAGE TO A FRIEND

ARL6

ADP-ribosylation factor-like 6

93 Gene Product Result for
Synonyms: BBS3 RP55
UniProtKB ID: Q9H0F7, A8KA93, D3DN31
Gene ID:
Human(84100) Summary: The protein encoded by this gene belongs to the ARF-like (ADP ribosylation factor-like) sub-family of the ARF family of GTP-binding proteins which are involved in regulation of intracellular traffic. Mutations in this gene are associated with Bardet-Biedl syndrome (BBS). Alternative splicing results in multiple transcript variants of this gene. A vision-specific transcript encoding a different protein has been described (PMID: 20333246). [provided by RefSeq, May 2013]
Mouse(56297) ADP-ribosylation factor-like 6
Rat(363760) ADP-ribosylation factor-like 6
sheep(101102858) ADP-ribosylation factor-like 6
domestic guinea pig(100721392) ADP-ribosylation factor-like 6
naked mole-rat(101698155) ADP-ribosylation factor-like 6
Zebrafish(494134) ADP-ribosylation factor-like 6
dog(612796) ADP-ribosylation factor-like 6
domestic cat(101082084) ADP-ribosylation factor-like 6
cow(519014) ADP-ribosylation factor-like 6
chicken(418433) ADP-ribosylation factor-like 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019665 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019665 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019665 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032146 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032146 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032146 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032146 Rosetta Predictions human pricing
NM_177976 Rosetta Predictions human pricing
NM_001108842 Rosetta Predictions rat pricing
NM_019665 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032146 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359379 predicted 586
2 SASI_Hs01_00146096 predicted 686
3 SASI_Hs01_00146097 predicted 745
4 SASI_Hs01_00146098 predicted 805
5 SASI_Hs01_00146099 predicted 717
6 SASI_Hs01_00146100 predicted 775
7 SASI_Hs01_00146102 predicted 887
8 SASI_Hs01_00146103 predicted 776
9 SASI_Hs01_00146104 predicted 693
10 SASI_Hs02_00359380 predicted 624
11 SASI_Hs01_00146101 predicted 693
12 SASI_Hs01_00146105 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177976 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369450 predicted 548
2 SASI_Hs01_00098576 predicted 644
3 SASI_Hs01_00098577 predicted 710
4 SASI_Hs01_00098578 predicted 763
5 SASI_Hs01_00098579 predicted 675
6 SASI_Hs01_00098580 predicted 730
7 SASI_Hs01_00098582 predicted 848
8 SASI_Hs01_00098583 predicted 737
9 SASI_Hs01_00098584 predicted 655
10 SASI_Hs02_00369451 predicted 588
11 SASI_Hs01_00098581 predicted 649
12 SASI_Hs01_00098585 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108842 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242615 predicted 726
2 SASI_Rn02_00242616 predicted 579
3 SASI_Rn02_00242617 predicted 515
4 SASI_Rn02_00242618 predicted 697
5 SASI_Rn02_00242619 predicted 714
6 SASI_Rn02_00242620 predicted 607
7 SASI_Rn02_00242621 predicted 611
8 SASI_Rn02_00242622 predicted 487
9 SASI_Rn02_00242623 predicted 533
10 SASI_Rn02_00242624 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019665 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148351 predicted 756
2 SASI_Mm01_00148352 predicted 875
3 SASI_Mm01_00148354 predicted 776
4 SASI_Mm01_00148355 predicted 789
5 SASI_Mm02_00324720 predicted 1049
6 SASI_Mm01_00148356 predicted 546
7 SASI_Mm01_00148357 predicted 768
8 SASI_Mm01_00148358 predicted 798
9 SASI_Mm01_00148359 predicted 718
10 SASI_Mm02_00324721 predicted 570
11 SASI_Mm01_00148350 predicted 861
12 SASI_Mm01_00148353 predicted 879
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019665
VALIDATED
ARL6 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019665.3-578s21c1
Sequence:GTACCGGAGTTCCAACCATAGGATTTAGCTCGAGCTAAATCCTATGGTTGGAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019665.3-896s21c1
Sequence:GTACCGGAGACAAGCCGTGGCATATTTGCTCGAGCAAATATGCCACGGCTTGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019665.3-772s21c1
Sequence:GTACCGGTTCTGAATCACCCAGATATTACTCGAGTAATATCTGGGTGATTCAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019665.2-1113s1c1
Sequence:CCGGGCCATCTCAATATCCTATCATCTCGAGATGATAGGATATTGAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019665.2-376s1c1
Sequence:CCGGCCAACGCTCAATCTCAAGATACTCGAGTATCTTGAGATTGAGCGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019665.2-377s1c1
Sequence:CCGGCAACGCTCAATCTCAAGATATCTCGAGATATCTTGAGATTGAGCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019665.2-617s1c1
Sequence:CCGGCCGTCGAATTCCAATCTTGTTCTCGAGAACAAGATTGGAATTCGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019665.2-603s1c1
Sequence:CCGGCCAGATATTAAGCACCGTCGACTCGAGTCGACGGTGCTTAATATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019665
VALIDATED
ARL6 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019665.3-578s21c1
Sequence:GTACCGGAGTTCCAACCATAGGATTTAGCTCGAGCTAAATCCTATGGTTGGAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019665.3-896s21c1
Sequence:GTACCGGAGACAAGCCGTGGCATATTTGCTCGAGCAAATATGCCACGGCTTGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019665.3-772s21c1
Sequence:GTACCGGTTCTGAATCACCCAGATATTACTCGAGTAATATCTGGGTGATTCAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019665.2-1113s1c1
Sequence:CCGGGCCATCTCAATATCCTATCATCTCGAGATGATAGGATATTGAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019665.2-376s1c1
Sequence:CCGGCCAACGCTCAATCTCAAGATACTCGAGTATCTTGAGATTGAGCGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019665.2-377s1c1
Sequence:CCGGCAACGCTCAATCTCAAGATATCTCGAGATATCTTGAGATTGAGCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019665.2-617s1c1
Sequence:CCGGCCGTCGAATTCCAATCTTGTTCTCGAGAACAAGATTGGAATTCGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019665.2-603s1c1
Sequence:CCGGCCAGATATTAAGCACCGTCGACTCGAGTCGACGGTGCTTAATATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019665
VALIDATED
ARL6 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019665.3-578s21c1
Sequence:GTACCGGAGTTCCAACCATAGGATTTAGCTCGAGCTAAATCCTATGGTTGGAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019665.3-896s21c1
Sequence:GTACCGGAGACAAGCCGTGGCATATTTGCTCGAGCAAATATGCCACGGCTTGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019665.3-772s21c1
Sequence:GTACCGGTTCTGAATCACCCAGATATTACTCGAGTAATATCTGGGTGATTCAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019665.2-1113s1c1
Sequence:CCGGGCCATCTCAATATCCTATCATCTCGAGATGATAGGATATTGAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019665.2-376s1c1
Sequence:CCGGCCAACGCTCAATCTCAAGATACTCGAGTATCTTGAGATTGAGCGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019665.2-377s1c1
Sequence:CCGGCAACGCTCAATCTCAAGATATCTCGAGATATCTTGAGATTGAGCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019665.2-617s1c1
Sequence:CCGGCCGTCGAATTCCAATCTTGTTCTCGAGAACAAGATTGGAATTCGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019665.2-603s1c1
Sequence:CCGGCCAGATATTAAGCACCGTCGACTCGAGTCGACGGTGCTTAATATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032146
VALIDATED
ARL6 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 6
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_032146.3-943s21c1
Sequence:GTACCGGTTTCAATTCAAGGAATCTATCCTCGAGGATAGATTCCTTGAATTGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_032146.3-1157s21c1
Sequence:GTACCGGCATTTGATTGTACGTAGAATGCTCGAGCATTCTACGTACAATCAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032146.3-713s1c1
Sequence:CCGGCCGTCGAATTCCAATCTTATTCTCGAGAATAAGATTGGAATTCGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_032146.3-819s1c1
Sequence:CCGGCCCTGGCATATTTGTGCTAGTCTCGAGACTAGCACAAATATGCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032146.3-445s1c1
Sequence:CCGGCGACGATCATTAACAAACTTACTCGAGTAAGTTTGTTAATGATCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_032146.3-702s1c1
Sequence:CCGGGATATTAAACACCGTCGAATTCTCGAGAATTCGACGGTGTTTAATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032146.3-498s1c1
Sequence:CCGGCCAACAATAGGATTCAGCATACTCGAGTATGCTGAATCCTATTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032146
VALIDATED
ARL6 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 6
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_032146.3-943s21c1
Sequence:GTACCGGTTTCAATTCAAGGAATCTATCCTCGAGGATAGATTCCTTGAATTGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_032146.3-1157s21c1
Sequence:GTACCGGCATTTGATTGTACGTAGAATGCTCGAGCATTCTACGTACAATCAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032146.3-713s1c1
Sequence:CCGGCCGTCGAATTCCAATCTTATTCTCGAGAATAAGATTGGAATTCGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_032146.3-819s1c1
Sequence:CCGGCCCTGGCATATTTGTGCTAGTCTCGAGACTAGCACAAATATGCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032146.3-445s1c1
Sequence:CCGGCGACGATCATTAACAAACTTACTCGAGTAAGTTTGTTAATGATCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_032146.3-702s1c1
Sequence:CCGGGATATTAAACACCGTCGAATTCTCGAGAATTCGACGGTGTTTAATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032146.3-498s1c1
Sequence:CCGGCCAACAATAGGATTCAGCATACTCGAGTATGCTGAATCCTATTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032146
VALIDATED
ARL6 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 6
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_032146.3-943s21c1
Sequence:GTACCGGTTTCAATTCAAGGAATCTATCCTCGAGGATAGATTCCTTGAATTGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_032146.3-1157s21c1
Sequence:GTACCGGCATTTGATTGTACGTAGAATGCTCGAGCATTCTACGTACAATCAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032146.3-713s1c1
Sequence:CCGGCCGTCGAATTCCAATCTTATTCTCGAGAATAAGATTGGAATTCGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_032146.3-819s1c1
Sequence:CCGGCCCTGGCATATTTGTGCTAGTCTCGAGACTAGCACAAATATGCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032146.3-445s1c1
Sequence:CCGGCGACGATCATTAACAAACTTACTCGAGTAAGTTTGTTAATGATCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_032146.3-702s1c1
Sequence:CCGGGATATTAAACACCGTCGAATTCTCGAGAATTCGACGGTGTTTAATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032146.3-498s1c1
Sequence:CCGGCCAACAATAGGATTCAGCATACTCGAGTATGCTGAATCCTATTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)