EMAIL THIS PAGE TO A FRIEND

ARL6IP1

ADP-ribosylation factor-like 6 interacting protein 1

112 Gene Product Result for
Synonyms: AIP1 ARL6IP ARMER
UniProtKB ID: Q15041
Gene ID:
Mouse(54208) ADP-ribosylation factor-like 6 interacting protein 1
Rat(293551) ADP-ribosylation factor-like 6 interacting protein 1
Zebrafish(394087) ADP-ribosylation factor-like 6 interacting protein 1
domestic cat(101095460) ADP-ribosylation factor-like 6 interacting protein 1
cow(777773) ADP-ribosylation factor-like 6 interacting protein 1
dog(480791) ADP-ribosylation factor-like 6 interacting protein 1
chicken(416604) ADP-ribosylation factor-like 6 interacting protein 1
naked mole-rat(101697530) ADP-ribosylation factor-like 6 interacting protein 1
domestic guinea pig(100713049) ADP-ribosylation factor-like 6 interacting protein 1
Goat(100861061) ADP-ribosylation factor-like 6 interacting protein 1
sheep(100302315) ADP-ribosylation factor-like 6 interacting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015161 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015161 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015161 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019419 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019419 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019419 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015161 Rosetta Predictions human pricing
NM_198737 Rosetta Predictions rat pricing
NM_019419 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233782 predicted 740
2 SASI_Hs01_00233783 predicted 551
3 SASI_Hs01_00233784 predicted 666
4 SASI_Hs01_00233785 predicted 461
5 SASI_Hs01_00233776 predicted 242
6 SASI_Hs02_00347136 predicted 363
7 SASI_Hs02_00347137 predicted 674
8 SASI_Hs02_00347138 predicted 377
9 SASI_Hs02_00347139 predicted 696
10 SASI_Hs02_00347140 predicted 737
11 SASI_Hs01_00233777 predicted 306
12 SASI_Hs01_00233778 predicted 236
13 SASI_Hs01_00233779 predicted 231
14 SASI_Hs01_00233780 predicted 251
15 SASI_Hs01_00233781 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198737 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269946 predicted 938
2 SASI_Rn02_00269947 predicted 344
3 SASI_Rn02_00269948 predicted 899
4 SASI_Rn02_00269949 predicted 918
5 SASI_Rn02_00269950 predicted 945
6 SASI_Rn02_00269951 predicted 578
7 SASI_Rn02_00269952 predicted 229
8 SASI_Rn02_00269953 predicted 293
9 SASI_Rn02_00269954 predicted 922
10 SASI_Rn02_00269955 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078164 predicted 859
2 SASI_Mm01_00078165 predicted 350
3 SASI_Mm01_00078166 predicted 908
4 SASI_Mm01_00078167 predicted 297
5 SASI_Mm01_00078168 predicted 345
6 SASI_Mm02_00324343 predicted 313
7 SASI_Mm01_00078169 predicted 904
8 SASI_Mm01_00078170 predicted 963
9 SASI_Mm01_00078171 predicted 842
10 SASI_Mm01_00078172 predicted 257
11 SASI_Mm01_00078163 predicted 973
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015161
VALIDATED
ARL6IP1 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 6 interacting protein 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015161.1-526s1c1
Sequence:CCGGCAACAAGTCCACAACCTGCTTCTCGAGAAGCAGGTTGTGGACTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_015161.1-370s1c1
Sequence:CCGGCAACAGCAAAGATTCCATGAACTCGAGTTCATGGAATCTTTGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015161.1-556s1c1
Sequence:CCGGCTGATAGTGACTTCCTTACTACTCGAGTAGTAAGGAAGTCACTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015161.1-612s1c1
Sequence:CCGGGAAGTACATTGGAATGGCCAACTCGAGTTGGCCATTCCAATGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015161.1-154s1c1
Sequence:CCGGGTGATGCTGATGGCTGATAAACTCGAGTTTATCAGCCATCAGCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015161.1-307s1c1
Sequence:CCGGGCTGACTACCTTGTTCCCATTCTCGAGAATGGGAACAAGGTAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015161.1-583s1c1
Sequence:CCGGCCTGGACTAAACCAACATGGACTCGAGTCCATGTTGGTTTAGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015161.1-861s1c1
Sequence:CCGGCGTATAGTTGAGCGCGTTCTTCTCGAGAAGAACGCGCTCAACTATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015161.1-861s21c1
Sequence:CCGGCGTATAGTTGAGCGCGTTCTTCTCGAGAAGAACGCGCTCAACTATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_015161.1-438s21c1
Sequence:CCGGGAAACGCCTCTTCACACTAAACTCGAGTTTAGTGTGAAGAGGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015161.1-583s21c1
Sequence:CCGGCCTGGACTAAACCAACATGGACTCGAGTCCATGTTGGTTTAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_015161.1-154s21c1
Sequence:CCGGGTGATGCTGATGGCTGATAAACTCGAGTTTATCAGCCATCAGCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015161.1-542s21c1
Sequence:CCGGTGCTTCTCACCTACCTGATAGCTCGAGCTATCAGGTAGGTGAGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015161
VALIDATED
ARL6IP1 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 6 interacting protein 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015161.1-526s1c1
Sequence:CCGGCAACAAGTCCACAACCTGCTTCTCGAGAAGCAGGTTGTGGACTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_015161.1-370s1c1
Sequence:CCGGCAACAGCAAAGATTCCATGAACTCGAGTTCATGGAATCTTTGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015161.1-556s1c1
Sequence:CCGGCTGATAGTGACTTCCTTACTACTCGAGTAGTAAGGAAGTCACTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015161.1-612s1c1
Sequence:CCGGGAAGTACATTGGAATGGCCAACTCGAGTTGGCCATTCCAATGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015161.1-154s1c1
Sequence:CCGGGTGATGCTGATGGCTGATAAACTCGAGTTTATCAGCCATCAGCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015161.1-307s1c1
Sequence:CCGGGCTGACTACCTTGTTCCCATTCTCGAGAATGGGAACAAGGTAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015161.1-583s1c1
Sequence:CCGGCCTGGACTAAACCAACATGGACTCGAGTCCATGTTGGTTTAGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015161.1-861s1c1
Sequence:CCGGCGTATAGTTGAGCGCGTTCTTCTCGAGAAGAACGCGCTCAACTATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015161.1-861s21c1
Sequence:CCGGCGTATAGTTGAGCGCGTTCTTCTCGAGAAGAACGCGCTCAACTATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_015161.1-438s21c1
Sequence:CCGGGAAACGCCTCTTCACACTAAACTCGAGTTTAGTGTGAAGAGGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015161.1-583s21c1
Sequence:CCGGCCTGGACTAAACCAACATGGACTCGAGTCCATGTTGGTTTAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_015161.1-154s21c1
Sequence:CCGGGTGATGCTGATGGCTGATAAACTCGAGTTTATCAGCCATCAGCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015161.1-542s21c1
Sequence:CCGGTGCTTCTCACCTACCTGATAGCTCGAGCTATCAGGTAGGTGAGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015161
VALIDATED
ARL6IP1 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 6 interacting protein 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015161.1-526s1c1
Sequence:CCGGCAACAAGTCCACAACCTGCTTCTCGAGAAGCAGGTTGTGGACTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_015161.1-370s1c1
Sequence:CCGGCAACAGCAAAGATTCCATGAACTCGAGTTCATGGAATCTTTGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015161.1-556s1c1
Sequence:CCGGCTGATAGTGACTTCCTTACTACTCGAGTAGTAAGGAAGTCACTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015161.1-612s1c1
Sequence:CCGGGAAGTACATTGGAATGGCCAACTCGAGTTGGCCATTCCAATGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015161.1-154s1c1
Sequence:CCGGGTGATGCTGATGGCTGATAAACTCGAGTTTATCAGCCATCAGCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015161.1-307s1c1
Sequence:CCGGGCTGACTACCTTGTTCCCATTCTCGAGAATGGGAACAAGGTAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015161.1-583s1c1
Sequence:CCGGCCTGGACTAAACCAACATGGACTCGAGTCCATGTTGGTTTAGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015161.1-861s1c1
Sequence:CCGGCGTATAGTTGAGCGCGTTCTTCTCGAGAAGAACGCGCTCAACTATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015161.1-861s21c1
Sequence:CCGGCGTATAGTTGAGCGCGTTCTTCTCGAGAAGAACGCGCTCAACTATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_015161.1-438s21c1
Sequence:CCGGGAAACGCCTCTTCACACTAAACTCGAGTTTAGTGTGAAGAGGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015161.1-583s21c1
Sequence:CCGGCCTGGACTAAACCAACATGGACTCGAGTCCATGTTGGTTTAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_015161.1-154s21c1
Sequence:CCGGGTGATGCTGATGGCTGATAAACTCGAGTTTATCAGCCATCAGCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015161.1-542s21c1
Sequence:CCGGTGCTTCTCACCTACCTGATAGCTCGAGCTATCAGGTAGGTGAGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019419
VALIDATED
ARL6IP1 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 6 interacting protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019419.1-154s1c1
Sequence:CCGGTGGCTGACAAAGTCCTTCGATCTCGAGATCGAAGGACTTTGTCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019419.1-313s1c1
Sequence:CCGGCCATTCTAGCACCAAGAATTTCTCGAGAAATTCTTGGTGCTAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019419.1-219s1c1
Sequence:CCGGCTGCTGTTCCTGATTATCTATCTCGAGATAGATAATCAGGAACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019419.1-579s1c1
Sequence:CCGGCTAAACCAACATGGGATCATTCTCGAGAATGATCCCATGTTGGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019419.1-1295s1c1
Sequence:CCGGGCAGTTTCTTTGTTTCAGATTCTCGAGAATCTGAAACAAAGAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019419.1-1295s21c1
Sequence:CCGGGCAGTTTCTTTGTTTCAGATTCTCGAGAATCTGAAACAAAGAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019419.1-154s21c1
Sequence:CCGGTGGCTGACAAAGTCCTTCGATCTCGAGATCGAAGGACTTTGTCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019419.1-219s21c1
Sequence:CCGGCTGCTGTTCCTGATTATCTATCTCGAGATAGATAATCAGGAACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019419.1-313s21c1
Sequence:CCGGCCATTCTAGCACCAAGAATTTCTCGAGAAATTCTTGGTGCTAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019419.1-579s21c1
Sequence:CCGGCTAAACCAACATGGGATCATTCTCGAGAATGATCCCATGTTGGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019419
VALIDATED
ARL6IP1 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 6 interacting protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019419.1-154s1c1
Sequence:CCGGTGGCTGACAAAGTCCTTCGATCTCGAGATCGAAGGACTTTGTCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019419.1-313s1c1
Sequence:CCGGCCATTCTAGCACCAAGAATTTCTCGAGAAATTCTTGGTGCTAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019419.1-219s1c1
Sequence:CCGGCTGCTGTTCCTGATTATCTATCTCGAGATAGATAATCAGGAACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019419.1-579s1c1
Sequence:CCGGCTAAACCAACATGGGATCATTCTCGAGAATGATCCCATGTTGGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019419.1-1295s1c1
Sequence:CCGGGCAGTTTCTTTGTTTCAGATTCTCGAGAATCTGAAACAAAGAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019419.1-1295s21c1
Sequence:CCGGGCAGTTTCTTTGTTTCAGATTCTCGAGAATCTGAAACAAAGAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019419.1-154s21c1
Sequence:CCGGTGGCTGACAAAGTCCTTCGATCTCGAGATCGAAGGACTTTGTCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019419.1-219s21c1
Sequence:CCGGCTGCTGTTCCTGATTATCTATCTCGAGATAGATAATCAGGAACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019419.1-313s21c1
Sequence:CCGGCCATTCTAGCACCAAGAATTTCTCGAGAAATTCTTGGTGCTAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019419.1-579s21c1
Sequence:CCGGCTAAACCAACATGGGATCATTCTCGAGAATGATCCCATGTTGGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019419
VALIDATED
ARL6IP1 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 6 interacting protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019419.1-154s1c1
Sequence:CCGGTGGCTGACAAAGTCCTTCGATCTCGAGATCGAAGGACTTTGTCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019419.1-313s1c1
Sequence:CCGGCCATTCTAGCACCAAGAATTTCTCGAGAAATTCTTGGTGCTAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019419.1-219s1c1
Sequence:CCGGCTGCTGTTCCTGATTATCTATCTCGAGATAGATAATCAGGAACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019419.1-579s1c1
Sequence:CCGGCTAAACCAACATGGGATCATTCTCGAGAATGATCCCATGTTGGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019419.1-1295s1c1
Sequence:CCGGGCAGTTTCTTTGTTTCAGATTCTCGAGAATCTGAAACAAAGAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019419.1-1295s21c1
Sequence:CCGGGCAGTTTCTTTGTTTCAGATTCTCGAGAATCTGAAACAAAGAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019419.1-154s21c1
Sequence:CCGGTGGCTGACAAAGTCCTTCGATCTCGAGATCGAAGGACTTTGTCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019419.1-219s21c1
Sequence:CCGGCTGCTGTTCCTGATTATCTATCTCGAGATAGATAATCAGGAACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019419.1-313s21c1
Sequence:CCGGCCATTCTAGCACCAAGAATTTCTCGAGAAATTCTTGGTGCTAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019419.1-579s21c1
Sequence:CCGGCTAAACCAACATGGGATCATTCTCGAGAATGATCCCATGTTGGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks