EMAIL THIS PAGE TO A FRIEND

ARL6IP4

ADP-ribosylation-like factor 6 interacting protein 4

89 Gene Product Result for
Synonyms: SFRS20 SR-25 SRp25 SRrp37
Gene ID:
Mouse(65105) ADP-ribosylation factor-like 6 interacting protein 4
Rat(288656) ADP-ribosylation-like factor 6 interacting protein 4
Zebrafish(553796) ADP-ribosylation-like factor 6 interacting protein 4
dog(608170) ADP-ribosylation-like factor 6 interacting protein 4
domestic cat(101090216) ADP-ribosylation-like factor 6 interacting protein 4
cow(526095) ADP-ribosylation-like factor 6 interacting protein 4
chicken(427695) ADP-ribosylation-like factor 6 interacting protein 4
sheep(101122815) ADP-ribosylation-like factor 6 interacting protein 4
domestic guinea pig(100735519) ADP-ribosylation-like factor 6 interacting protein 4
naked mole-rat(101719814) ADP-ribosylation-like factor 6 interacting protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018694 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018694 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018694 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016638 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016638 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016638 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144509 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144509 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144509 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002251 Rosetta Predictions human pricing
NM_001002252 Rosetta Predictions human pricing
NM_016638 Rosetta Predictions human pricing
NM_018694 Rosetta Predictions human pricing
NM_001025630 Rosetta Predictions rat pricing
NM_144509 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002251 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242378 predicted 269
2 SASI_Hs01_00242379 predicted 224
3 SASI_Hs01_00242380 predicted 1006
4 SASI_Hs01_00242382 predicted 1000
5 SASI_Hs01_00242383 predicted 1312
6 SASI_Hs01_00242384 predicted 898
7 SASI_Hs01_00242385 predicted 899
8 SASI_Hs01_00242386 predicted 950
9 SASI_Hs01_00242387 predicted 1029
10 SASI_Hs02_00304140 predicted 1178
11 SASI_Hs01_00242381 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002252 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116691 predicted 266
2 SASI_Hs01_00116692 predicted 221
3 SASI_Hs01_00116693 predicted 968
4 SASI_Hs02_00304141 predicted 968
5 SASI_Hs01_00116696 predicted 1356
6 SASI_Hs01_00116697 predicted 868
7 SASI_Hs02_00304142 predicted 864
8 SASI_Hs01_00116699 predicted 1056
9 SASI_Hs01_00116700 predicted 912
10 SASI_Hs02_00304143 predicted 1228
11 SASI_Hs01_00116694 predicted 1010
12 SASI_Hs01_00116695 predicted 999
13 SASI_Hs01_00116698 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016638 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205491 predicted 273
2 SASI_Hs01_00205492 predicted 223
3 SASI_Hs01_00205493 predicted 973
4 SASI_Hs01_00205495 predicted 966
5 SASI_Hs01_00205496 predicted 1279
6 SASI_Hs01_00205497 predicted 860
7 SASI_Hs01_00205498 predicted 867
8 SASI_Hs01_00205499 predicted 919
9 SASI_Hs01_00205500 predicted 995
10 SASI_Hs02_00349802 predicted 1141
11 SASI_Hs01_00205494 predicted 994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018694 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149155 predicted 275
2 SASI_Hs01_00149156 predicted 220
3 SASI_Hs01_00149157 predicted 1055
4 SASI_Hs01_00149158 predicted 1025
5 SASI_Hs01_00149159 predicted 1026
6 SASI_Hs01_00149160 predicted 1327
7 SASI_Hs01_00149161 predicted 924
8 SASI_Hs01_00149162 predicted 920
9 SASI_Hs02_00352219 predicted 610
10 SASI_Hs01_00149163 predicted 968
11 SASI_Hs01_00149164 predicted 1063
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025630 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109430 predicted 950
2 SASI_Rn01_00109431 predicted 939
3 SASI_Rn01_00109432 predicted 908
4 SASI_Rn01_00109433 predicted 945
5 SASI_Rn01_00109434 predicted 939
6 SASI_Rn01_00109435 predicted 929
7 SASI_Rn01_00109436 predicted 908
8 SASI_Rn01_00109437 predicted 943
9 SASI_Rn01_00109438 predicted 921
10 SASI_Rn01_00109439 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144509 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082362 predicted 367
2 SASI_Mm01_00082363 predicted 347
3 SASI_Mm01_00082364 predicted 349
4 SASI_Mm01_00082365 predicted 371
5 SASI_Mm01_00082368 predicted 906
6 SASI_Mm01_00082369 predicted 371
7 SASI_Mm01_00082370 predicted 340
8 SASI_Mm02_00340027 predicted 906
9 SASI_Mm02_00340028 predicted 334
10 SASI_Mm02_00340029 predicted 927
11 SASI_Mm01_00082361 predicted 953
12 SASI_Mm01_00082366 predicted 945
13 SASI_Mm01_00082367 predicted 949
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018694
VALIDATED
ARL6IP4 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation-like factor 6 interacting protein 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018694.1-242s1c1
Sequence:CCGGGAGAAAGAAGAAGAGCAGGAACTCGAGTTCCTGCTCTTCTTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018694.1-475s1c1
Sequence:CCGGGAAGCACAGCAGAACATCATCCTCGAGGATGATGTTCTGCTGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018694.1-330s1c1
Sequence:CCGGGAGGTTCTTCTAGCTCCTCTTCTCGAGAAGAGGAGCTAGAAGAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018694.1-445s1c1
Sequence:CCGGGAACTGAAGAAGAAGGGCAAGCTCGAGCTTGCCCTTCTTCTTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018694.1-413s1c1
Sequence:CCGGGACAAGAGGAGGAAGAAGAAGCTCGAGCTTCTTCTTCCTCCTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018694.1-450s1c1
Sequence:CCGGGAAGAAGAAGGGCAAGGAGAACTCGAGTTCTCCTTGCCCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018694.1-403s1c1
Sequence:CCGGGAAGTACAAGGACAAGAGGAGCTCGAGCTCCTCTTGTCCTTGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018694.1-415s1c1
Sequence:CCGGCAAGAGGAGGAAGAAGAAGAACTCGAGTTCTTCTTCTTCCTCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018694.1-427s1c1
Sequence:CCGGGAAGAAGAAGAAGAGGAAGAACTCGAGTTCTTCCTCTTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018694.1-424s1c1
Sequence:CCGGGAAGAAGAAGAAGAAGAGGAACTCGAGTTCCTCTTCTTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018694
VALIDATED
ARL6IP4 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation-like factor 6 interacting protein 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018694.1-242s1c1
Sequence:CCGGGAGAAAGAAGAAGAGCAGGAACTCGAGTTCCTGCTCTTCTTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018694.1-475s1c1
Sequence:CCGGGAAGCACAGCAGAACATCATCCTCGAGGATGATGTTCTGCTGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018694.1-330s1c1
Sequence:CCGGGAGGTTCTTCTAGCTCCTCTTCTCGAGAAGAGGAGCTAGAAGAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018694.1-445s1c1
Sequence:CCGGGAACTGAAGAAGAAGGGCAAGCTCGAGCTTGCCCTTCTTCTTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018694.1-413s1c1
Sequence:CCGGGACAAGAGGAGGAAGAAGAAGCTCGAGCTTCTTCTTCCTCCTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018694.1-450s1c1
Sequence:CCGGGAAGAAGAAGGGCAAGGAGAACTCGAGTTCTCCTTGCCCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018694.1-403s1c1
Sequence:CCGGGAAGTACAAGGACAAGAGGAGCTCGAGCTCCTCTTGTCCTTGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018694.1-415s1c1
Sequence:CCGGCAAGAGGAGGAAGAAGAAGAACTCGAGTTCTTCTTCTTCCTCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018694.1-427s1c1
Sequence:CCGGGAAGAAGAAGAAGAGGAAGAACTCGAGTTCTTCCTCTTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018694.1-424s1c1
Sequence:CCGGGAAGAAGAAGAAGAAGAGGAACTCGAGTTCCTCTTCTTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018694
VALIDATED
ARL6IP4 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation-like factor 6 interacting protein 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018694.1-242s1c1
Sequence:CCGGGAGAAAGAAGAAGAGCAGGAACTCGAGTTCCTGCTCTTCTTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018694.1-475s1c1
Sequence:CCGGGAAGCACAGCAGAACATCATCCTCGAGGATGATGTTCTGCTGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018694.1-330s1c1
Sequence:CCGGGAGGTTCTTCTAGCTCCTCTTCTCGAGAAGAGGAGCTAGAAGAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018694.1-445s1c1
Sequence:CCGGGAACTGAAGAAGAAGGGCAAGCTCGAGCTTGCCCTTCTTCTTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018694.1-413s1c1
Sequence:CCGGGACAAGAGGAGGAAGAAGAAGCTCGAGCTTCTTCTTCCTCCTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018694.1-450s1c1
Sequence:CCGGGAAGAAGAAGGGCAAGGAGAACTCGAGTTCTCCTTGCCCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018694.1-403s1c1
Sequence:CCGGGAAGTACAAGGACAAGAGGAGCTCGAGCTCCTCTTGTCCTTGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018694.1-415s1c1
Sequence:CCGGCAAGAGGAGGAAGAAGAAGAACTCGAGTTCTTCTTCTTCCTCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018694.1-427s1c1
Sequence:CCGGGAAGAAGAAGAAGAGGAAGAACTCGAGTTCTTCCTCTTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018694.1-424s1c1
Sequence:CCGGGAAGAAGAAGAAGAAGAGGAACTCGAGTTCCTCTTCTTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016638
VALIDATED
ARL6IP4 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation-like factor 6 interacting protein 4
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000141661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016638.1-185s1c1
Sequence:CCGGCCAAGAGAGAAGCAAGCAGAACTCGAGTTCTGCTTGCTTCTCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016638.1-612s1c1
Sequence:CCGGGAGGTCCTAGAGGAAATCGTACTCGAGTACGATTTCCTCTAGGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016638.1-621s1c1
Sequence:CCGGGAGGAAATCGTAACCAAAGAACTCGAGTTCTTTGGTTACGATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016638
VALIDATED
ARL6IP4 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation-like factor 6 interacting protein 4
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000141661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016638.1-185s1c1
Sequence:CCGGCCAAGAGAGAAGCAAGCAGAACTCGAGTTCTGCTTGCTTCTCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016638.1-612s1c1
Sequence:CCGGGAGGTCCTAGAGGAAATCGTACTCGAGTACGATTTCCTCTAGGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016638.1-621s1c1
Sequence:CCGGGAGGAAATCGTAACCAAAGAACTCGAGTTCTTTGGTTACGATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016638
VALIDATED
ARL6IP4 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation-like factor 6 interacting protein 4
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000141661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016638.1-185s1c1
Sequence:CCGGCCAAGAGAGAAGCAAGCAGAACTCGAGTTCTGCTTGCTTCTCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016638.1-612s1c1
Sequence:CCGGGAGGTCCTAGAGGAAATCGTACTCGAGTACGATTTCCTCTAGGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016638.1-621s1c1
Sequence:CCGGGAGGAAATCGTAACCAAAGAACTCGAGTTCTTTGGTTACGATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144509
ARL6IP4 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation-like factor 6 interacting protein 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144509.1-623s1c1
Sequence:CCGGGCACAAGGAGAAGAAGAGGAACTCGAGTTCCTCTTCTTCTCCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144509.1-821s1c1
Sequence:CCGGGAAACCCATGACAAAGGAGGACTCGAGTCCTCCTTTGTCATGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144509.1-626s1c1
Sequence:CCGGCAAGGAGAAGAAGAGGAAGAACTCGAGTTCTTCCTCTTCTTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144509.1-954s1c1
Sequence:CCGGCACAGAGAGATCAACAAGCAACTCGAGTTGCTTGTTGATCTCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144509.1-939s1c1
Sequence:CCGGGTAACCAAAGAACGACACAGACTCGAGTCTGTGTCGTTCTTTGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144509.1-644s1c1
Sequence:CCGGGAAGAAGAAGAAGAAACGGAACTCGAGTTCCGTTTCTTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144509.1-650s1c1
Sequence:CCGGGAAGAAGAAACGGAAGAAGAACTCGAGTTCTTCTTCCGTTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144509
ARL6IP4 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation-like factor 6 interacting protein 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144509.1-623s1c1
Sequence:CCGGGCACAAGGAGAAGAAGAGGAACTCGAGTTCCTCTTCTTCTCCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144509.1-821s1c1
Sequence:CCGGGAAACCCATGACAAAGGAGGACTCGAGTCCTCCTTTGTCATGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144509.1-626s1c1
Sequence:CCGGCAAGGAGAAGAAGAGGAAGAACTCGAGTTCTTCCTCTTCTTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144509.1-954s1c1
Sequence:CCGGCACAGAGAGATCAACAAGCAACTCGAGTTGCTTGTTGATCTCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144509.1-939s1c1
Sequence:CCGGGTAACCAAAGAACGACACAGACTCGAGTCTGTGTCGTTCTTTGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144509.1-644s1c1
Sequence:CCGGGAAGAAGAAGAAGAAACGGAACTCGAGTTCCGTTTCTTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144509.1-650s1c1
Sequence:CCGGGAAGAAGAAACGGAAGAAGAACTCGAGTTCTTCTTCCGTTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144509
ARL6IP4 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation-like factor 6 interacting protein 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144509.1-623s1c1
Sequence:CCGGGCACAAGGAGAAGAAGAGGAACTCGAGTTCCTCTTCTTCTCCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144509.1-821s1c1
Sequence:CCGGGAAACCCATGACAAAGGAGGACTCGAGTCCTCCTTTGTCATGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144509.1-626s1c1
Sequence:CCGGCAAGGAGAAGAAGAGGAAGAACTCGAGTTCTTCCTCTTCTTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144509.1-954s1c1
Sequence:CCGGCACAGAGAGATCAACAAGCAACTCGAGTTGCTTGTTGATCTCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144509.1-939s1c1
Sequence:CCGGGTAACCAAAGAACGACACAGACTCGAGTCTGTGTCGTTCTTTGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144509.1-644s1c1
Sequence:CCGGGAAGAAGAAGAAGAAACGGAACTCGAGTTCCGTTTCTTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144509.1-650s1c1
Sequence:CCGGGAAGAAGAAACGGAAGAAGAACTCGAGTTCTTCTTCCGTTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks