EMAIL THIS PAGE TO A FRIEND

ARL6IP5

ADP-ribosylation-like factor 6 interacting protein 5

104 Gene Product Result for
Synonyms: DERP11 GTRAP3-18 JWA PRAF3 addicsin hp22 jmx
UniProtKB ID: O75915, B2R6V5, Q53ES3, Q5KU08
Gene ID:
Human(10550) Summary: Expression of this gene is affected by vitamin A. The encoded protein of this gene may be associated with the cytoskeleton. A similar protein in rats may play a role in the regulation of cell differentiation. The rat protein binds and inhibits the cell membrane glutamate transporter EAAC1. The expression of the rat gene is upregulated by retinoic acid, which results in a specific reduction in EAAC1-mediated glutamate transport. [provided by RefSeq, Jul 2008]
Mouse(65106) ADP-ribosylation factor-like 6 interacting protein 5
Rat(66028) ADP-ribosylation-like factor 6 interacting protein 5
naked mole-rat(101717335) ADP-ribosylation-like factor 6 interacting protein 5
domestic guinea pig(100731761) ADP-ribosylation-like factor 6 interacting protein 5
sheep(101116352) ADP-ribosylation-like factor 6 interacting protein 5
chicken(426074) ADP-ribosylation-like factor 6 interacting protein 5
domestic cat(101090425) ADP-ribosylation-like factor 6 interacting protein 5
cow(509977) ADP-ribosylation-like factor 6 interacting protein 5
dog(476559) ADP-ribosylation-like factor 6 interacting protein 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022992 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022992 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022992 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006407 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006407 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006407 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006407 Rosetta Predictions human pricing
NM_023972 Rosetta Predictions rat pricing
NM_022992 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093199 predicted 687
2 SASI_Hs01_00093202 predicted 678
3 SASI_Hs01_00093203 predicted 257
4 SASI_Hs01_00093204 predicted 416
5 SASI_Hs01_00093206 predicted 308
6 SASI_Hs01_00093207 predicted 395
7 SASI_Hs02_00341496 predicted 415
8 SASI_Hs02_00341497 predicted 619
9 SASI_Hs02_00341498 predicted 724
10 SASI_Hs02_00341499 predicted 593
11 SASI_Hs01_00093198 predicted 524
12 SASI_Hs01_00093200 predicted 471
13 SASI_Hs01_00093201 predicted 647
14 SASI_Hs01_00093205 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023972 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263781 predicted 238
2 SASI_Rn01_00117997 predicted 254
3 SASI_Rn02_00263782 predicted 292
4 SASI_Rn02_00263783 predicted 295
5 SASI_Rn02_00263784 predicted 298
6 SASI_Rn02_00263785 predicted 280
7 SASI_Rn02_00263786 predicted 205
8 SASI_Rn02_00263787 predicted 310
9 SASI_Rn02_00263788 predicted 262
10 SASI_Rn02_00263789 predicted 262
11 SASI_Rn01_00117996 predicted 1023
12 SASI_Rn01_00117998 predicted 1006
13 SASI_Rn01_00117999 predicted 1017
14 SASI_Rn01_00118000 predicted 1013
15 SASI_Rn01_00118001 predicted 732
16 SASI_Rn01_00118002 predicted 725
17 SASI_Rn01_00118003 predicted 876
18 SASI_Rn01_00118004 predicted 811
19 SASI_Rn01_00118005 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022992 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036116 predicted 290
2 SASI_Mm01_00036117 predicted 742
3 SASI_Mm01_00036118 predicted 925
4 SASI_Mm01_00036119 predicted 942
5 SASI_Mm01_00036120 predicted 1016
6 SASI_Mm01_00036121 predicted 1024
7 SASI_Mm02_00326714 predicted 623
8 SASI_Mm01_00036122 predicted 388
9 SASI_Mm01_00036123 predicted 707
10 SASI_Mm01_00036124 predicted 760
11 SASI_Mm01_00036115 predicted 951
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022992
ARL6IP5 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation-like factor 6 interacting protein 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022992.1-920s1c1
Sequence:CCGGGAGGACATGAAGATCAGTTAACTCGAGTTAACTGATCTTCATGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022992.1-149s1c1
Sequence:CCGGGCTCTATTACCAGACCAACTACTCGAGTAGTTGGTCTGGTAATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022992.1-137s1c1
Sequence:CCGGAGTGAGCAATCTGCTCTATTACTCGAGTAATAGAGCAGATTGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022992.1-183s1c1
Sequence:CCGGGCCATGATGATTTCGGTTGTTCTCGAGAACAACCGAAATCATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022992.1-542s1c1
Sequence:CCGGGCAGGAAGATAACATCAACAACTCGAGTTGTTGATGTTATCTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022992.2-542s21c1
Sequence:CCGGGCAGGAAGATAACATCAACAACTCGAGTTGTTGATGTTATCTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022992.2-270s21c1
Sequence:CCGGGTGTGGGCAGCGCACAATAAACTCGAGTTTATTGTGCGCTGCCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022992.2-226s21c1
Sequence:CCGGTGATCCTCGGAGGAGTCATTGCTCGAGCAATGACTCCTCCGAGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022992.2-920s21c1
Sequence:CCGGGAGGACATGAAGATCAGTTAACTCGAGTTAACTGATCTTCATGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022992.2-183s21c1
Sequence:CCGGGCCATGATGATTTCGGTTGTTCTCGAGAACAACCGAAATCATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022992
ARL6IP5 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation-like factor 6 interacting protein 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022992.1-920s1c1
Sequence:CCGGGAGGACATGAAGATCAGTTAACTCGAGTTAACTGATCTTCATGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022992.1-149s1c1
Sequence:CCGGGCTCTATTACCAGACCAACTACTCGAGTAGTTGGTCTGGTAATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022992.1-137s1c1
Sequence:CCGGAGTGAGCAATCTGCTCTATTACTCGAGTAATAGAGCAGATTGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022992.1-183s1c1
Sequence:CCGGGCCATGATGATTTCGGTTGTTCTCGAGAACAACCGAAATCATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022992.1-542s1c1
Sequence:CCGGGCAGGAAGATAACATCAACAACTCGAGTTGTTGATGTTATCTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022992.2-542s21c1
Sequence:CCGGGCAGGAAGATAACATCAACAACTCGAGTTGTTGATGTTATCTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022992.2-270s21c1
Sequence:CCGGGTGTGGGCAGCGCACAATAAACTCGAGTTTATTGTGCGCTGCCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022992.2-226s21c1
Sequence:CCGGTGATCCTCGGAGGAGTCATTGCTCGAGCAATGACTCCTCCGAGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022992.2-920s21c1
Sequence:CCGGGAGGACATGAAGATCAGTTAACTCGAGTTAACTGATCTTCATGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022992.2-183s21c1
Sequence:CCGGGCCATGATGATTTCGGTTGTTCTCGAGAACAACCGAAATCATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022992
ARL6IP5 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation-like factor 6 interacting protein 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022992.1-920s1c1
Sequence:CCGGGAGGACATGAAGATCAGTTAACTCGAGTTAACTGATCTTCATGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022992.1-149s1c1
Sequence:CCGGGCTCTATTACCAGACCAACTACTCGAGTAGTTGGTCTGGTAATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022992.1-137s1c1
Sequence:CCGGAGTGAGCAATCTGCTCTATTACTCGAGTAATAGAGCAGATTGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022992.1-183s1c1
Sequence:CCGGGCCATGATGATTTCGGTTGTTCTCGAGAACAACCGAAATCATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022992.1-542s1c1
Sequence:CCGGGCAGGAAGATAACATCAACAACTCGAGTTGTTGATGTTATCTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022992.2-542s21c1
Sequence:CCGGGCAGGAAGATAACATCAACAACTCGAGTTGTTGATGTTATCTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022992.2-270s21c1
Sequence:CCGGGTGTGGGCAGCGCACAATAAACTCGAGTTTATTGTGCGCTGCCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022992.2-226s21c1
Sequence:CCGGTGATCCTCGGAGGAGTCATTGCTCGAGCAATGACTCCTCCGAGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022992.2-920s21c1
Sequence:CCGGGAGGACATGAAGATCAGTTAACTCGAGTTAACTGATCTTCATGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022992.2-183s21c1
Sequence:CCGGGCCATGATGATTTCGGTTGTTCTCGAGAACAACCGAAATCATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006407
ARL6IP5 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation-like factor 6 interacting protein 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006407.2-206s1c1
Sequence:CCGGCCTGCTCTATTACCAGACCAACTCGAGTTGGTCTGGTAATAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006407.2-614s1c1
Sequence:CCGGCATCAACAGACTCACTGACTACTCGAGTAGTCAGTGAGTCTGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006407.2-386s1c1
Sequence:CCGGGACGTTCGTTATGGTGGTCATCTCGAGATGACCACCATAACGAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006407.2-339s1c1
Sequence:CCGGGCCCACAATAAAGACGTCCTTCTCGAGAAGGACGTCTTTATTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006407.2-416s1c1
Sequence:CCGGCTATTTCCTTATCTCCATGTTCTCGAGAACATGGAGATAAGGAAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006407.3-436s21c1
Sequence:CCGGCTATTTCCTTATCTCCATGTTCTCGAGAACATGGAGATAAGGAAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006407.3-406s21c1
Sequence:CCGGGACGTTCGTTATGGTGGTCATCTCGAGATGACCACCATAACGAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006407.3-226s21c1
Sequence:CCGGCCTGCTCTATTACCAGACCAACTCGAGTTGGTCTGGTAATAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006407.3-634s21c1
Sequence:CCGGCATCAACAGACTCACTGACTACTCGAGTAGTCAGTGAGTCTGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006407
ARL6IP5 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation-like factor 6 interacting protein 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006407.2-206s1c1
Sequence:CCGGCCTGCTCTATTACCAGACCAACTCGAGTTGGTCTGGTAATAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006407.2-614s1c1
Sequence:CCGGCATCAACAGACTCACTGACTACTCGAGTAGTCAGTGAGTCTGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006407.2-386s1c1
Sequence:CCGGGACGTTCGTTATGGTGGTCATCTCGAGATGACCACCATAACGAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006407.2-339s1c1
Sequence:CCGGGCCCACAATAAAGACGTCCTTCTCGAGAAGGACGTCTTTATTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006407.2-416s1c1
Sequence:CCGGCTATTTCCTTATCTCCATGTTCTCGAGAACATGGAGATAAGGAAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006407.3-436s21c1
Sequence:CCGGCTATTTCCTTATCTCCATGTTCTCGAGAACATGGAGATAAGGAAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006407.3-406s21c1
Sequence:CCGGGACGTTCGTTATGGTGGTCATCTCGAGATGACCACCATAACGAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006407.3-226s21c1
Sequence:CCGGCCTGCTCTATTACCAGACCAACTCGAGTTGGTCTGGTAATAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006407.3-634s21c1
Sequence:CCGGCATCAACAGACTCACTGACTACTCGAGTAGTCAGTGAGTCTGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006407
ARL6IP5 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation-like factor 6 interacting protein 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006407.2-206s1c1
Sequence:CCGGCCTGCTCTATTACCAGACCAACTCGAGTTGGTCTGGTAATAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006407.2-614s1c1
Sequence:CCGGCATCAACAGACTCACTGACTACTCGAGTAGTCAGTGAGTCTGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006407.2-386s1c1
Sequence:CCGGGACGTTCGTTATGGTGGTCATCTCGAGATGACCACCATAACGAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006407.2-339s1c1
Sequence:CCGGGCCCACAATAAAGACGTCCTTCTCGAGAAGGACGTCTTTATTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006407.2-416s1c1
Sequence:CCGGCTATTTCCTTATCTCCATGTTCTCGAGAACATGGAGATAAGGAAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006407.3-436s21c1
Sequence:CCGGCTATTTCCTTATCTCCATGTTCTCGAGAACATGGAGATAAGGAAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006407.3-406s21c1
Sequence:CCGGGACGTTCGTTATGGTGGTCATCTCGAGATGACCACCATAACGAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006407.3-226s21c1
Sequence:CCGGCCTGCTCTATTACCAGACCAACTCGAGTTGGTCTGGTAATAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006407.3-634s21c1
Sequence:CCGGCATCAACAGACTCACTGACTACTCGAGTAGTCAGTGAGTCTGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks