EMAIL THIS PAGE TO A FRIEND

ARL6IP6

ADP-ribosylation-like factor 6 interacting protein 6

132 Gene Product Result for
Synonyms: AIP-6 PFAAP1
UniProtKB ID: Q8N6S5, B2RDS6, Q7Z4G7
Gene ID:
Mouse(65103) ADP-ribosylation factor-like 6 interacting protein 6
Rat(499798) ADP-ribosylation-like factor 6 interacting protein 6
Zebrafish(100037347) ADP-ribosylation-like factor 6 interacting protein 6
dog(609760) ADP-ribosylation-like factor 6 interacting protein 6
domestic cat(101082079) ADP-ribosylation-like factor 6 interacting protein 6
cow(507137) ADP-ribosylation-like factor 6 interacting protein 6
sheep(101116126) ADP-ribosylation-like factor 6 interacting protein 6
domestic guinea pig(101787553) ADP-ribosylation-like factor 6 interacting protein 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152522 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152522 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152522 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022989 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022989 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022989 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152522 Rosetta Predictions human pricing
NM_001024310 Rosetta Predictions rat pricing
NM_022989 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152522 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157931 predicted 774
2 SASI_Hs01_00157932 predicted 826
3 SASI_Hs01_00157933 predicted 464
4 SASI_Hs01_00157934 predicted 524
5 SASI_Hs01_00157936 predicted 644
6 SASI_Hs01_00157937 predicted 470
7 SASI_Hs01_00157939 predicted 449
8 SASI_Hs02_00366316 predicted 961
9 SASI_Hs02_00366317 predicted 817
10 SASI_Hs02_00366318 predicted 775
11 SASI_Hs01_00157935 predicted 884
12 SASI_Hs01_00157938 predicted 602
13 SASI_Hs01_00157940 predicted 870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024310 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202516 predicted 751
2 SASI_Rn01_00079731 predicted 513
3 SASI_Rn01_00079732 predicted 773
4 SASI_Rn01_00079733 predicted 480
5 SASI_Rn01_00079734 predicted 243
6 SASI_Rn01_00079736 predicted 551
7 SASI_Rn01_00079737 predicted 778
8 SASI_Rn01_00079739 predicted 463
9 SASI_Rn01_00079740 predicted 671
10 SASI_Rn02_00202517 predicted 682
11 SASI_Rn01_00079735 predicted 311
12 SASI_Rn01_00079738 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022989 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186065 predicted 747
2 SASI_Mm01_00186068 predicted 262
3 SASI_Mm02_00326712 predicted 784
4 SASI_Mm01_00186069 predicted 591
5 SASI_Mm01_00186070 predicted 493
6 SASI_Mm01_00186071 predicted 779
7 SASI_Mm01_00186072 predicted 702
8 SASI_Mm01_00186073 predicted 710
9 SASI_Mm01_00186074 predicted 481
10 SASI_Mm02_00326713 predicted 773
11 SASI_Mm01_00186066 predicted 576
12 SASI_Mm01_00186067 predicted 331
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152522
ARL6IP6 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation-like factor 6 interacting protein 6
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152522.4-1398s21c1
Sequence:CCGGACCCACACTGGAGCGATATTGCTCGAGCAATATCGCTCCAGTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152522.4-1228s21c1
Sequence:CCGGCTTGGACAGTGACTTACTTTGCTCGAGCAAAGTAAGTCACTGTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152522.4-970s21c1
Sequence:CCGGATAAGCGCAATGGTATCTTTCCTCGAGGAAAGATACCATTGCGCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152522.4-1330s21c1
Sequence:CCGGTGGGCTATAGCATGGCGATTTCTCGAGAAATCGCCATGCTATAGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152522.4-1095s21c1
Sequence:CCGGATCGCCTACTTGATCGTTAAACTCGAGTTTAACGATCAAGTAGGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167280    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152522.2-1011s1c1
Sequence:CCGGCAAACTTGAATACAGGACAATCTCGAGATTGTCCTGTATTCAAGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152522.2-389s1c1
Sequence:CCGGCCATCGCCTACTTGATCGTTACTCGAGTAACGATCAAGTAGGCGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152522
ARL6IP6 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation-like factor 6 interacting protein 6
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152522.4-1398s21c1
Sequence:CCGGACCCACACTGGAGCGATATTGCTCGAGCAATATCGCTCCAGTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152522.4-1228s21c1
Sequence:CCGGCTTGGACAGTGACTTACTTTGCTCGAGCAAAGTAAGTCACTGTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152522.4-970s21c1
Sequence:CCGGATAAGCGCAATGGTATCTTTCCTCGAGGAAAGATACCATTGCGCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152522.4-1330s21c1
Sequence:CCGGTGGGCTATAGCATGGCGATTTCTCGAGAAATCGCCATGCTATAGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152522.4-1095s21c1
Sequence:CCGGATCGCCTACTTGATCGTTAAACTCGAGTTTAACGATCAAGTAGGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167280    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152522.2-1011s1c1
Sequence:CCGGCAAACTTGAATACAGGACAATCTCGAGATTGTCCTGTATTCAAGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152522.2-389s1c1
Sequence:CCGGCCATCGCCTACTTGATCGTTACTCGAGTAACGATCAAGTAGGCGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152522
ARL6IP6 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation-like factor 6 interacting protein 6
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152522.4-1398s21c1
Sequence:CCGGACCCACACTGGAGCGATATTGCTCGAGCAATATCGCTCCAGTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152522.4-1228s21c1
Sequence:CCGGCTTGGACAGTGACTTACTTTGCTCGAGCAAAGTAAGTCACTGTCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152522.4-970s21c1
Sequence:CCGGATAAGCGCAATGGTATCTTTCCTCGAGGAAAGATACCATTGCGCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152522.4-1330s21c1
Sequence:CCGGTGGGCTATAGCATGGCGATTTCTCGAGAAATCGCCATGCTATAGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152522.4-1095s21c1
Sequence:CCGGATCGCCTACTTGATCGTTAAACTCGAGTTTAACGATCAAGTAGGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167280    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152522.2-1011s1c1
Sequence:CCGGCAAACTTGAATACAGGACAATCTCGAGATTGTCCTGTATTCAAGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152522.2-389s1c1
Sequence:CCGGCCATCGCCTACTTGATCGTTACTCGAGTAACGATCAAGTAGGCGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022989
VALIDATED
ARL6IP6 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation-like factor 6 interacting protein 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022989.2-395s1c1
Sequence:CCGGGCCTACATGATCGTTAAAGAACTCGAGTTCTTTAACGATCATGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022989.2-394s1c1
Sequence:CCGGCGCCTACATGATCGTTAAAGACTCGAGTCTTTAACGATCATGTAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022989.2-590s1c1
Sequence:CCGGGCTAGGTTCAAGAAACTGACTCTCGAGAGTCAGTTTCTTGAACCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022989.2-2087s1c1
Sequence:CCGGCCAATTAAAGTGAGTGATGAACTCGAGTTCATCACTCACTTTAATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022989.2-446s1c1
Sequence:CCGGGATATACATACTGGGCTGTTACTCGAGTAACAGCCCAGTATGTATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022989
VALIDATED
ARL6IP6 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation-like factor 6 interacting protein 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022989.2-395s1c1
Sequence:CCGGGCCTACATGATCGTTAAAGAACTCGAGTTCTTTAACGATCATGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022989.2-394s1c1
Sequence:CCGGCGCCTACATGATCGTTAAAGACTCGAGTCTTTAACGATCATGTAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022989.2-590s1c1
Sequence:CCGGGCTAGGTTCAAGAAACTGACTCTCGAGAGTCAGTTTCTTGAACCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022989.2-2087s1c1
Sequence:CCGGCCAATTAAAGTGAGTGATGAACTCGAGTTCATCACTCACTTTAATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022989.2-446s1c1
Sequence:CCGGGATATACATACTGGGCTGTTACTCGAGTAACAGCCCAGTATGTATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022989
VALIDATED
ARL6IP6 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation-like factor 6 interacting protein 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022989.2-395s1c1
Sequence:CCGGGCCTACATGATCGTTAAAGAACTCGAGTTCTTTAACGATCATGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022989.2-394s1c1
Sequence:CCGGCGCCTACATGATCGTTAAAGACTCGAGTCTTTAACGATCATGTAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022989.2-590s1c1
Sequence:CCGGGCTAGGTTCAAGAAACTGACTCTCGAGAGTCAGTTTCTTGAACCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022989.2-2087s1c1
Sequence:CCGGCCAATTAAAGTGAGTGATGAACTCGAGTTCATCACTCACTTTAATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022989.2-446s1c1
Sequence:CCGGGATATACATACTGGGCTGTTACTCGAGTAACAGCCCAGTATGTATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)