EMAIL THIS PAGE TO A FRIEND

ARL8A

ADP-ribosylation factor-like 8A

49 Gene Product Result for
Synonyms: ARL10B GIE2
UniProtKB ID: Q96BM9, B3KXD0
Gene ID:
Mouse(68724) ADP-ribosylation factor-like 8A
Rat(498234) ADP-ribosylation factor-like 8A
Zebrafish(567222) ADP-ribosylation factor-like 8A
domestic cat(101100858) ADP-ribosylation factor-like 8A
cow(101906089) ADP-ribosylation factor-like 8A
dog(480000) ADP-ribosylation factor-like 8A
chicken(421175) ADP-ribosylation factor-like 8A
naked mole-rat(101715879) ADP-ribosylation factor-like 8A
domestic guinea pig(100723944) ADP-ribosylation factor-like 8A
sheep(100302316) ADP-ribosylation factor-like 8A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138795 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138795 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138795 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026823 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026823 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026823 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016111 MISSION® esiRNA esiRNA targeting human ARL8A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138795 Rosetta Predictions human pricing
NM_001109071 Rosetta Predictions rat pricing
NM_026823 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138795 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172302 predicted 755
2 SASI_Hs01_00172304 predicted 683
3 SASI_Hs01_00172305 predicted 669
4 SASI_Hs01_00172306 predicted 487
5 SASI_Hs01_00172308 predicted 553
6 SASI_Hs01_00172309 predicted 478
7 SASI_Hs01_00172310 predicted 741
8 SASI_Hs01_00172311 predicted 468
9 SASI_Hs01_00172303 predicted 633
10 SASI_Hs02_00363948 predicted 695
11 SASI_Hs01_00172307 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109071 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244840 predicted 524
2 SASI_Rn02_00244841 predicted 646
3 SASI_Rn02_00244842 predicted 412
4 SASI_Rn02_00244843 predicted 481
5 SASI_Rn02_00244844 predicted 670
6 SASI_Rn02_00244845 predicted 711
7 SASI_Rn02_00244846 predicted 270
8 SASI_Rn02_00244847 predicted 566
9 SASI_Rn02_00244848 predicted 386
10 SASI_Rn02_00244849 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026823 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197210 predicted 471
2 SASI_Mm01_00197211 predicted 459
3 SASI_Mm01_00197212 predicted 656
4 SASI_Mm01_00197213 predicted 710
5 SASI_Mm01_00197214 predicted 556
6 SASI_Mm01_00197215 predicted 603
7 SASI_Mm01_00197216 predicted 371
8 SASI_Mm01_00197217 predicted 250
9 SASI_Mm01_00197218 predicted 375
10 SASI_Mm01_00197219 predicted 382
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138795
VALIDATED
ARL8A MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 8A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_138795.2-1685s1c1
Sequence:CCGGGCTCATATTTAACCTCTGTTTCTCGAGAAACAGAGGTTAAATATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_138795.2-497s1c1
Sequence:CCGGCTCCACAACCTACTGGACAAACTCGAGTTTGTCCAGTAGGTTGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138795.2-535s1c1
Sequence:CCGGCCCGGTCTTAGTCCTGGGTAACTCGAGTTACCCAGGACTAAGACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_138795.2-323s1c1
Sequence:CCGGGTGGGTTTCAACATGCGCAAACTCGAGTTTGCGCATGTTGAAACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_138795.2-208s1c1
Sequence:CCGGCCTATTCTGGAAGGAGGAGATCTCGAGATCTCCTCCTTCCAGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138795.2-1069s21c1
Sequence:CCGGGTCCTGTGTGTACAGTATATACTCGAGTATATACTGTACACACAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_138795.2-679s21c1
Sequence:CCGGCATCACCCTACAGTGGCTTATCTCGAGATAAGCCACTGTAGGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138795.2-498s21c1
Sequence:CCGGTCCACAACCTACTGGACAAACCTCGAGGTTTGTCCAGTAGGTTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138795.2-470s21c1
Sequence:CCGGGAGAAGATTGAGGCCTCTAAGCTCGAGCTTAGAGGCCTCAATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138795.2-194s21c1
Sequence:CCGGGACTGGTTCAAGGCCCTATTCCTCGAGGAATAGGGCCTTGAACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138795
VALIDATED
ARL8A MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 8A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_138795.2-1685s1c1
Sequence:CCGGGCTCATATTTAACCTCTGTTTCTCGAGAAACAGAGGTTAAATATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_138795.2-497s1c1
Sequence:CCGGCTCCACAACCTACTGGACAAACTCGAGTTTGTCCAGTAGGTTGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138795.2-535s1c1
Sequence:CCGGCCCGGTCTTAGTCCTGGGTAACTCGAGTTACCCAGGACTAAGACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_138795.2-323s1c1
Sequence:CCGGGTGGGTTTCAACATGCGCAAACTCGAGTTTGCGCATGTTGAAACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_138795.2-208s1c1
Sequence:CCGGCCTATTCTGGAAGGAGGAGATCTCGAGATCTCCTCCTTCCAGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138795.2-1069s21c1
Sequence:CCGGGTCCTGTGTGTACAGTATATACTCGAGTATATACTGTACACACAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_138795.2-679s21c1
Sequence:CCGGCATCACCCTACAGTGGCTTATCTCGAGATAAGCCACTGTAGGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138795.2-498s21c1
Sequence:CCGGTCCACAACCTACTGGACAAACCTCGAGGTTTGTCCAGTAGGTTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138795.2-470s21c1
Sequence:CCGGGAGAAGATTGAGGCCTCTAAGCTCGAGCTTAGAGGCCTCAATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138795.2-194s21c1
Sequence:CCGGGACTGGTTCAAGGCCCTATTCCTCGAGGAATAGGGCCTTGAACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138795
VALIDATED
ARL8A MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 8A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_138795.2-1685s1c1
Sequence:CCGGGCTCATATTTAACCTCTGTTTCTCGAGAAACAGAGGTTAAATATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_138795.2-497s1c1
Sequence:CCGGCTCCACAACCTACTGGACAAACTCGAGTTTGTCCAGTAGGTTGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138795.2-535s1c1
Sequence:CCGGCCCGGTCTTAGTCCTGGGTAACTCGAGTTACCCAGGACTAAGACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_138795.2-323s1c1
Sequence:CCGGGTGGGTTTCAACATGCGCAAACTCGAGTTTGCGCATGTTGAAACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_138795.2-208s1c1
Sequence:CCGGCCTATTCTGGAAGGAGGAGATCTCGAGATCTCCTCCTTCCAGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138795.2-1069s21c1
Sequence:CCGGGTCCTGTGTGTACAGTATATACTCGAGTATATACTGTACACACAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_138795.2-679s21c1
Sequence:CCGGCATCACCCTACAGTGGCTTATCTCGAGATAAGCCACTGTAGGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138795.2-498s21c1
Sequence:CCGGTCCACAACCTACTGGACAAACCTCGAGGTTTGTCCAGTAGGTTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138795.2-470s21c1
Sequence:CCGGGAGAAGATTGAGGCCTCTAAGCTCGAGCTTAGAGGCCTCAATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138795.2-194s21c1
Sequence:CCGGGACTGGTTCAAGGCCCTATTCCTCGAGGAATAGGGCCTTGAACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026823
VALIDATED
ARL8A MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 8A
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026823.1-1020s1c1
Sequence:CCGGCCCTTTCAACACTCTGTTATTCTCGAGAATAACAGAGTGTTGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026823.1-555s1c1
Sequence:CCGGGCTAGATGAGAAGGAGCTAATCTCGAGATTAGCTCCTTCTCATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026823.1-300s1c1
Sequence:CCGGTGTGGGTTTCAACATGCGAAACTCGAGTTTCGCATGTTGAAACCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026823.1-415s1c1
Sequence:CCGGGCCATTGTGTATATGGTGGATCTCGAGATCCACCATATACACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026823.1-646s1c1
Sequence:CCGGGACAACATAGACATCACCCTACTCGAGTAGGGTGATGTCTATGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026823.2-407s21c1
Sequence:GTACCGGGAGTGAGCGCCATTGTGTATACTCGAGTATACACAATGGCGCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026823.2-611s21c1
Sequence:CCGGAGATCTGCTGCTACTCCATATCTCGAGATATGGAGTAGCAGCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026823.2-1020s21c1
Sequence:CCGGCCCTTTCAACACTCTGTTATTCTCGAGAATAACAGAGTGTTGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026823.2-555s21c1
Sequence:CCGGGCTAGATGAGAAGGAGCTAATCTCGAGATTAGCTCCTTCTCATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026823.2-186s21c1
Sequence:CCGGCCTGTTCTGGAAGGAGGAAATCTCGAGATTTCCTCCTTCCAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026823.2-503s21c1
Sequence:CCGGTACAAGGCATCCCGGTCTTAGCTCGAGCTAAGACCGGGATGCCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026823
VALIDATED
ARL8A MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 8A
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026823.1-1020s1c1
Sequence:CCGGCCCTTTCAACACTCTGTTATTCTCGAGAATAACAGAGTGTTGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026823.1-555s1c1
Sequence:CCGGGCTAGATGAGAAGGAGCTAATCTCGAGATTAGCTCCTTCTCATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026823.1-300s1c1
Sequence:CCGGTGTGGGTTTCAACATGCGAAACTCGAGTTTCGCATGTTGAAACCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026823.1-415s1c1
Sequence:CCGGGCCATTGTGTATATGGTGGATCTCGAGATCCACCATATACACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026823.1-646s1c1
Sequence:CCGGGACAACATAGACATCACCCTACTCGAGTAGGGTGATGTCTATGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026823.2-407s21c1
Sequence:GTACCGGGAGTGAGCGCCATTGTGTATACTCGAGTATACACAATGGCGCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026823.2-611s21c1
Sequence:CCGGAGATCTGCTGCTACTCCATATCTCGAGATATGGAGTAGCAGCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026823.2-1020s21c1
Sequence:CCGGCCCTTTCAACACTCTGTTATTCTCGAGAATAACAGAGTGTTGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026823.2-555s21c1
Sequence:CCGGGCTAGATGAGAAGGAGCTAATCTCGAGATTAGCTCCTTCTCATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026823.2-186s21c1
Sequence:CCGGCCTGTTCTGGAAGGAGGAAATCTCGAGATTTCCTCCTTCCAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026823.2-503s21c1
Sequence:CCGGTACAAGGCATCCCGGTCTTAGCTCGAGCTAAGACCGGGATGCCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026823
VALIDATED
ARL8A MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 8A
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026823.1-1020s1c1
Sequence:CCGGCCCTTTCAACACTCTGTTATTCTCGAGAATAACAGAGTGTTGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026823.1-555s1c1
Sequence:CCGGGCTAGATGAGAAGGAGCTAATCTCGAGATTAGCTCCTTCTCATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026823.1-300s1c1
Sequence:CCGGTGTGGGTTTCAACATGCGAAACTCGAGTTTCGCATGTTGAAACCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026823.1-415s1c1
Sequence:CCGGGCCATTGTGTATATGGTGGATCTCGAGATCCACCATATACACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026823.1-646s1c1
Sequence:CCGGGACAACATAGACATCACCCTACTCGAGTAGGGTGATGTCTATGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026823.2-407s21c1
Sequence:GTACCGGGAGTGAGCGCCATTGTGTATACTCGAGTATACACAATGGCGCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026823.2-611s21c1
Sequence:CCGGAGATCTGCTGCTACTCCATATCTCGAGATATGGAGTAGCAGCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026823.2-1020s21c1
Sequence:CCGGCCCTTTCAACACTCTGTTATTCTCGAGAATAACAGAGTGTTGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026823.2-555s21c1
Sequence:CCGGGCTAGATGAGAAGGAGCTAATCTCGAGATTAGCTCCTTCTCATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026823.2-186s21c1
Sequence:CCGGCCTGTTCTGGAAGGAGGAAATCTCGAGATTTCCTCCTTCCAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026823.2-503s21c1
Sequence:CCGGTACAAGGCATCCCGGTCTTAGCTCGAGCTAAGACCGGGATGCCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks