EMAIL THIS PAGE TO A FRIEND

ARL8B

ADP-ribosylation factor-like 8B

195 Gene Product Result for
Synonyms: ARL10C Gie1
UniProtKB ID: Q9NVJ2
Gene ID:
Mouse(67166) ADP-ribosylation factor-like 8B
Rat(500282) ADP-ribosylation factor-like 8B
sheep(100302317) ADP-ribosylation factor-like 8B
naked mole-rat(101708918) ADP-ribosylation factor-like 8B
chicken(416109) ADP-ribosylation factor-like 8B
cow(511009) ADP-ribosylation factor-like 8B
domestic cat(101080438) ADP-ribosylation factor-like 8B
dog(612944) ADP-ribosylation factor-like 8B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018184 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018184 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018184 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026011 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026011 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026011 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018184 Rosetta Predictions human pricing
NM_001024332 Rosetta Predictions rat pricing
NM_026011 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018184 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078048 predicted 717
2 SASI_Hs01_00078049 predicted 548
3 SASI_Hs01_00078050 predicted 390
4 SASI_Hs01_00078051 predicted 735
5 SASI_Hs01_00078052 predicted 617
6 SASI_Hs01_00078054 predicted 469
7 SASI_Hs02_00351449 predicted 338
8 SASI_Hs01_00078057 predicted 782
9 SASI_Hs02_00351450 predicted 444
10 SASI_Hs02_00351451 predicted 541
11 SASI_Hs01_00078053 predicted 635
12 SASI_Hs01_00078055 predicted 808
13 SASI_Hs01_00078056 predicted 613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024332 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068919 predicted 357
2 SASI_Rn01_00068920 predicted 656
3 SASI_Rn01_00068921 predicted 483
4 SASI_Rn01_00068922 predicted 498
5 SASI_Rn01_00068923 predicted 505
6 SASI_Rn01_00068924 predicted 359
7 SASI_Rn01_00068925 predicted 632
8 SASI_Rn01_00068926 predicted 622
9 SASI_Rn01_00068927 predicted 809
10 SASI_Rn01_00068928 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026011 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102494 predicted 612
2 SASI_Mm01_00102495 predicted 543
3 SASI_Mm02_00329477 predicted 565
4 SASI_Mm01_00102496 predicted 369
5 SASI_Mm01_00102497 predicted 508
6 SASI_Mm01_00102498 predicted 671
7 SASI_Mm01_00102499 predicted 793
8 SASI_Mm01_00102500 predicted 713
9 SASI_Mm01_00102501 predicted 643
10 SASI_Mm01_00102502 predicted 524
11 SASI_Mm01_00102503 predicted 455
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018184
VALIDATED
ARL8B MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 8B
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018184.2-250s21c1
Sequence:GTACCGGACTGGTTCCGTTCGCTCTTCTCTCGAGAGAAGAGCGAACGGAACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018184.2-562s21c1
Sequence:CCGGTTCTAGATAAACCACAGTTACCTCGAGGTAACTGTGGTTTATCTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_018184.2-407s21c1
Sequence:CCGGAGGTAACGTCACAATAAAGATCTCGAGATCTTTATTGTGACGTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_018184.2-697s21c1
Sequence:CCGGGCTATTCAATTTCTTGCAAAGCTCGAGCTTTGCAAGAAATTGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018184.2-671s21c1
Sequence:CCGGTGCTATTCAGGATAGAGAAATCTCGAGATTTCTCTATCCTGAATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018184.2-482s21c1
Sequence:GTACCGGAGGAGTCAATGCTATTGTTTACTCGAGTAAACAATAGCATTGACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018184.2-801s21c1
Sequence:GTACCGGCCAGTCCTTCTTGGCTATAATCTCGAGATTATAGCCAAGAAGGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297011    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_018184.2-1259s21c1
Sequence:CCGGATGACTCATGTGGGATATATGCTCGAGCATATATCCCACATGAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018184.2-1167s21c1
Sequence:GTACCGGTATAGAGTCCAGTAGCTTAATCTCGAGATTAAGCTACTGGACTCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018184.2-335s21c1
Sequence:GTACCGGTGTCATCGCGTCAGGTCAATTCTCGAGAATTGACCTGACGCGATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018184.2-1878s1c1
Sequence:CCGGGCCTGCTTTATCTAATGTAATCTCGAGATTACATTAGATAAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_018184.2-746s1c1
Sequence:CCGGGTGGCTTATTCAGCATTCAAACTCGAGTTTGAATGCTGAATAAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018184.2-407s1c1
Sequence:CCGGAGGTAACGTCACAATAAAGATCTCGAGATCTTTATTGTGACGTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018184.2-346s1c1
Sequence:CCGGCAGGTCAATTCAGTGAAGATACTCGAGTATCTTCACTGAATTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018184.2-537s1c1
Sequence:CCGGGCTTCCCGAAATGAGCTACATCTCGAGATGTAGCTCATTTCGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018184
VALIDATED
ARL8B MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 8B
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018184.2-250s21c1
Sequence:GTACCGGACTGGTTCCGTTCGCTCTTCTCTCGAGAGAAGAGCGAACGGAACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018184.2-562s21c1
Sequence:CCGGTTCTAGATAAACCACAGTTACCTCGAGGTAACTGTGGTTTATCTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_018184.2-407s21c1
Sequence:CCGGAGGTAACGTCACAATAAAGATCTCGAGATCTTTATTGTGACGTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_018184.2-697s21c1
Sequence:CCGGGCTATTCAATTTCTTGCAAAGCTCGAGCTTTGCAAGAAATTGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018184.2-671s21c1
Sequence:CCGGTGCTATTCAGGATAGAGAAATCTCGAGATTTCTCTATCCTGAATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018184.2-482s21c1
Sequence:GTACCGGAGGAGTCAATGCTATTGTTTACTCGAGTAAACAATAGCATTGACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018184.2-801s21c1
Sequence:GTACCGGCCAGTCCTTCTTGGCTATAATCTCGAGATTATAGCCAAGAAGGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297011    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_018184.2-1259s21c1
Sequence:CCGGATGACTCATGTGGGATATATGCTCGAGCATATATCCCACATGAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018184.2-1167s21c1
Sequence:GTACCGGTATAGAGTCCAGTAGCTTAATCTCGAGATTAAGCTACTGGACTCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018184.2-335s21c1
Sequence:GTACCGGTGTCATCGCGTCAGGTCAATTCTCGAGAATTGACCTGACGCGATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018184.2-1878s1c1
Sequence:CCGGGCCTGCTTTATCTAATGTAATCTCGAGATTACATTAGATAAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_018184.2-746s1c1
Sequence:CCGGGTGGCTTATTCAGCATTCAAACTCGAGTTTGAATGCTGAATAAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018184.2-407s1c1
Sequence:CCGGAGGTAACGTCACAATAAAGATCTCGAGATCTTTATTGTGACGTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018184.2-346s1c1
Sequence:CCGGCAGGTCAATTCAGTGAAGATACTCGAGTATCTTCACTGAATTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018184.2-537s1c1
Sequence:CCGGGCTTCCCGAAATGAGCTACATCTCGAGATGTAGCTCATTTCGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018184
VALIDATED
ARL8B MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 8B
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018184.2-250s21c1
Sequence:GTACCGGACTGGTTCCGTTCGCTCTTCTCTCGAGAGAAGAGCGAACGGAACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018184.2-562s21c1
Sequence:CCGGTTCTAGATAAACCACAGTTACCTCGAGGTAACTGTGGTTTATCTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_018184.2-407s21c1
Sequence:CCGGAGGTAACGTCACAATAAAGATCTCGAGATCTTTATTGTGACGTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_018184.2-697s21c1
Sequence:CCGGGCTATTCAATTTCTTGCAAAGCTCGAGCTTTGCAAGAAATTGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018184.2-671s21c1
Sequence:CCGGTGCTATTCAGGATAGAGAAATCTCGAGATTTCTCTATCCTGAATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018184.2-482s21c1
Sequence:GTACCGGAGGAGTCAATGCTATTGTTTACTCGAGTAAACAATAGCATTGACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018184.2-801s21c1
Sequence:GTACCGGCCAGTCCTTCTTGGCTATAATCTCGAGATTATAGCCAAGAAGGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297011    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_018184.2-1259s21c1
Sequence:CCGGATGACTCATGTGGGATATATGCTCGAGCATATATCCCACATGAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018184.2-1167s21c1
Sequence:GTACCGGTATAGAGTCCAGTAGCTTAATCTCGAGATTAAGCTACTGGACTCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018184.2-335s21c1
Sequence:GTACCGGTGTCATCGCGTCAGGTCAATTCTCGAGAATTGACCTGACGCGATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018184.2-1878s1c1
Sequence:CCGGGCCTGCTTTATCTAATGTAATCTCGAGATTACATTAGATAAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_018184.2-746s1c1
Sequence:CCGGGTGGCTTATTCAGCATTCAAACTCGAGTTTGAATGCTGAATAAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018184.2-407s1c1
Sequence:CCGGAGGTAACGTCACAATAAAGATCTCGAGATCTTTATTGTGACGTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018184.2-346s1c1
Sequence:CCGGCAGGTCAATTCAGTGAAGATACTCGAGTATCTTCACTGAATTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018184.2-537s1c1
Sequence:CCGGGCTTCCCGAAATGAGCTACATCTCGAGATGTAGCTCATTTCGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026011
VALIDATED
ARL8B MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 8B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026011.2-270s1c1
Sequence:CCGGCCGGTCAATTCAGTGAAGATACTCGAGTATCTTCACTGAATTGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026011.2-462s1c1
Sequence:CCGGCCTCTCGAAATGAACTGCATACTCGAGTATGCAGTTCATTTCGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026011.2-461s1c1
Sequence:CCGGGCCTCTCGAAATGAACTGCATCTCGAGATGCAGTTCATTTCGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026011.2-1615s1c1
Sequence:CCGGCCACCCTTAATTCCTGACTTTCTCGAGAAAGTCAGGAATTAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026011.2-404s1c1
Sequence:CCGGCGAGGAGTCAATGCAATTGTTCTCGAGAACAATTGCATTGACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026011
VALIDATED
ARL8B MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 8B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026011.2-270s1c1
Sequence:CCGGCCGGTCAATTCAGTGAAGATACTCGAGTATCTTCACTGAATTGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026011.2-462s1c1
Sequence:CCGGCCTCTCGAAATGAACTGCATACTCGAGTATGCAGTTCATTTCGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026011.2-461s1c1
Sequence:CCGGGCCTCTCGAAATGAACTGCATCTCGAGATGCAGTTCATTTCGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026011.2-1615s1c1
Sequence:CCGGCCACCCTTAATTCCTGACTTTCTCGAGAAAGTCAGGAATTAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026011.2-404s1c1
Sequence:CCGGCGAGGAGTCAATGCAATTGTTCTCGAGAACAATTGCATTGACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026011
VALIDATED
ARL8B MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 8B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026011.2-270s1c1
Sequence:CCGGCCGGTCAATTCAGTGAAGATACTCGAGTATCTTCACTGAATTGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026011.2-462s1c1
Sequence:CCGGCCTCTCGAAATGAACTGCATACTCGAGTATGCAGTTCATTTCGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026011.2-461s1c1
Sequence:CCGGGCCTCTCGAAATGAACTGCATCTCGAGATGCAGTTCATTTCGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026011.2-1615s1c1
Sequence:CCGGCCACCCTTAATTCCTGACTTTCTCGAGAAAGTCAGGAATTAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026011.2-404s1c1
Sequence:CCGGCGAGGAGTCAATGCAATTGTTCTCGAGAACAATTGCATTGACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks