EMAIL THIS PAGE TO A FRIEND

ARL9

ADP-ribosylation factor-like 9

52 Gene Product Result for
UniProtKB ID: Q6T311
Gene ID:
Human(132946) Summary: ARL9 is a member of the small GTPase protein family with a high degree of similarity to ARF (MIM 103180) proteins of the RAS superfamily.[supplied by OMIM, Nov 2008]
Mouse(384185) ADP-ribosylation factor-like 9
Rat(289565) ADP-ribosylation factor-like 9
Zebrafish(751670) ADP-ribosylation factor-like 9
chicken(771078) ADP-ribosylation factor-like 9
domestic cat(101087736) ADP-ribosylation factor-like 9
dog(482161) ADP-ribosylation factor-like 9
cow(539310) ADP-ribosylation factor-like 9
naked mole-rat(101720420) ADP-ribosylation factor-like 9
domestic guinea pig(100728056) ADP-ribosylation factor-like 9
sheep(101117670) ADP-ribosylation factor-like 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_206919 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_206919 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_206919 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_206935 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_206935 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_206935 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_206919 Rosetta Predictions human pricing
NM_212459 Rosetta Predictions rat pricing
NM_206935 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206919 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164884 predicted 552
2 SASI_Hs01_00164885 predicted 505
3 SASI_Hs01_00164886 predicted 484
4 SASI_Hs02_00373609 predicted 607
5 SASI_Hs01_00164887 predicted 457
6 SASI_Hs01_00164890 predicted 486
7 SASI_Hs02_00373610 predicted 521
8 SASI_Hs01_00164891 predicted 564
9 SASI_Hs01_00164892 predicted 459
10 SASI_Hs01_00164893 predicted 587
11 SASI_Hs01_00164888 predicted 551
12 SASI_Hs01_00164889 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212459 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049084 predicted 368
2 SASI_Rn01_00049085 predicted 247
3 SASI_Rn01_00049086 predicted 359
4 SASI_Rn01_00049087 predicted 252
5 SASI_Rn01_00049089 predicted 321
6 SASI_Rn01_00049090 predicted 297
7 SASI_Rn01_00049091 predicted 249
8 SASI_Rn01_00049092 predicted 338
9 SASI_Rn01_00049093 predicted 198
10 SASI_Rn02_00270463 predicted 376
11 SASI_Rn01_00049088 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206935 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351836 predicted 68
2 SASI_Mm01_00188131 predicted 355
3 SASI_Mm02_00351837 predicted 353
4 SASI_Mm02_00351838 predicted 104
5 SASI_Mm01_00188133 predicted 313
6 SASI_Mm02_00351839 predicted 319
7 SASI_Mm01_00188134 predicted 83
8 SASI_Mm02_00351840 predicted 105
9 SASI_Mm01_00188135 predicted 291
10 SASI_Mm01_00188137 predicted 321
11 SASI_Mm01_00188129 predicted 282
12 SASI_Mm01_00188130 predicted 141
13 SASI_Mm01_00188132 predicted 233
14 SASI_Mm01_00188136 predicted 153
15 SASI_Mm01_00188138 predicted 182
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206919
ARL9 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 9
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206919.1-650s1c1
Sequence:CCGGGCAGCCTATCACATTACAGATCTCGAGATCTGTAATGTGATAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206919.1-686s1c1
Sequence:CCGGGCATTATCTGAAGTGGGAAATCTCGAGATTTCCCACTTCAGATAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206919.1-489s1c1
Sequence:CCGGCCTACTGGGAAATGTACCTATCTCGAGATAGGTACATTTCCCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206919.1-629s1c1
Sequence:CCGGGCAAACAAACAGGATCTTGAACTCGAGTTCAAGATCCTGTTTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206919.1-566s1c1
Sequence:CCGGGAAGCCAAGAAATACCTTCATCTCGAGATGAAGGTATTTCTTGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206919.1-513s21c1
Sequence:GTACCGGAGGGATTGCTGCTGATCTTTGCTCGAGCAAAGATCAGCAGCAATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206919.1-645s21c1
Sequence:GTACCGGTTGAAGCAGCCTATCACATTACTCGAGTAATGTGATAGGCTGCTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206919.1-630s21c1
Sequence:GTACCGGCAAACAAACAGGATCTTGAAGCTCGAGCTTCAAGATCCTGTTTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206919.1-607s21c1
Sequence:GTACCGGAGTACTTCCTCTGGTTGTGTTCTCGAGAACACAACCAGAGGAAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206919.1-542s21c1
Sequence:GTACCGGTCAGCAGATCACAGCCGATTACTCGAGTAATCGGCTGTGATCTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206919.1-524s21c1
Sequence:GTACCGGCTGATCTTTGTGGTGGATTCACTCGAGTGAATCCACCACAAAGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206919.1-665s21c1
Sequence:GTACCGGACAGATATCCATGAAGCTTTGCTCGAGCAAAGCTTCATGGATATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206919
ARL9 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 9
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206919.1-650s1c1
Sequence:CCGGGCAGCCTATCACATTACAGATCTCGAGATCTGTAATGTGATAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206919.1-686s1c1
Sequence:CCGGGCATTATCTGAAGTGGGAAATCTCGAGATTTCCCACTTCAGATAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206919.1-489s1c1
Sequence:CCGGCCTACTGGGAAATGTACCTATCTCGAGATAGGTACATTTCCCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206919.1-629s1c1
Sequence:CCGGGCAAACAAACAGGATCTTGAACTCGAGTTCAAGATCCTGTTTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206919.1-566s1c1
Sequence:CCGGGAAGCCAAGAAATACCTTCATCTCGAGATGAAGGTATTTCTTGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206919.1-513s21c1
Sequence:GTACCGGAGGGATTGCTGCTGATCTTTGCTCGAGCAAAGATCAGCAGCAATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206919.1-645s21c1
Sequence:GTACCGGTTGAAGCAGCCTATCACATTACTCGAGTAATGTGATAGGCTGCTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206919.1-630s21c1
Sequence:GTACCGGCAAACAAACAGGATCTTGAAGCTCGAGCTTCAAGATCCTGTTTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206919.1-607s21c1
Sequence:GTACCGGAGTACTTCCTCTGGTTGTGTTCTCGAGAACACAACCAGAGGAAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206919.1-542s21c1
Sequence:GTACCGGTCAGCAGATCACAGCCGATTACTCGAGTAATCGGCTGTGATCTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206919.1-524s21c1
Sequence:GTACCGGCTGATCTTTGTGGTGGATTCACTCGAGTGAATCCACCACAAAGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206919.1-665s21c1
Sequence:GTACCGGACAGATATCCATGAAGCTTTGCTCGAGCAAAGCTTCATGGATATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206919
ARL9 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 9
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206919.1-650s1c1
Sequence:CCGGGCAGCCTATCACATTACAGATCTCGAGATCTGTAATGTGATAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206919.1-686s1c1
Sequence:CCGGGCATTATCTGAAGTGGGAAATCTCGAGATTTCCCACTTCAGATAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206919.1-489s1c1
Sequence:CCGGCCTACTGGGAAATGTACCTATCTCGAGATAGGTACATTTCCCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206919.1-629s1c1
Sequence:CCGGGCAAACAAACAGGATCTTGAACTCGAGTTCAAGATCCTGTTTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206919.1-566s1c1
Sequence:CCGGGAAGCCAAGAAATACCTTCATCTCGAGATGAAGGTATTTCTTGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206919.1-513s21c1
Sequence:GTACCGGAGGGATTGCTGCTGATCTTTGCTCGAGCAAAGATCAGCAGCAATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206919.1-645s21c1
Sequence:GTACCGGTTGAAGCAGCCTATCACATTACTCGAGTAATGTGATAGGCTGCTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206919.1-630s21c1
Sequence:GTACCGGCAAACAAACAGGATCTTGAAGCTCGAGCTTCAAGATCCTGTTTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206919.1-607s21c1
Sequence:GTACCGGAGTACTTCCTCTGGTTGTGTTCTCGAGAACACAACCAGAGGAAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206919.1-542s21c1
Sequence:GTACCGGTCAGCAGATCACAGCCGATTACTCGAGTAATCGGCTGTGATCTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206919.1-524s21c1
Sequence:GTACCGGCTGATCTTTGTGGTGGATTCACTCGAGTGAATCCACCACAAAGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206919.1-665s21c1
Sequence:GTACCGGACAGATATCCATGAAGCTTTGCTCGAGCAAAGCTTCATGGATATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206935
ARL9 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 9
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206935.1-163s1c1
Sequence:CCGGGCAGTTCACATCAACTCTGAACTCGAGTTCAGAGTTGATGTGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206935.1-145s1c1
Sequence:CCGGCCTACCCAAGGTTTAAATGCACTCGAGTGCATTTAAACCTTGGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206935.1-57s1c1
Sequence:CCGGGCAGATCCTAGTACTAGGTCTCTCGAGAGACCTAGTACTAGGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206935.1-189s1c1
Sequence:CCGGGCAAATGGAGTTCCTGGAGATCTCGAGATCTCCAGGAACTCCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206935.1-140s1c1
Sequence:CCGGCAGCTCCTACCCAAGGTTTAACTCGAGTTAAACCTTGGGTAGGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206935.1-179s1c1
Sequence:CCGGCTGAAGATAGGCAAATGGAGTCTCGAGACTCCATTTGCCTATCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206935.1-161s21c1
Sequence:GTACCGGATGCAGTTCACATCAACTCTGCTCGAGCAGAGTTGATGTGAACTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206935.1-194s21c1
Sequence:GTACCGGTGGAGTTCCTGGAGATTGGTGCTCGAGCACCAATCTCCAGGAACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206935.1-231s21c1
Sequence:GTACCGGCTCCTACTGGGAGATGTACCTCTCGAGAGGTACATCTCCCAGTAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206935.1-139s21c1
Sequence:GTACCGGACAGCTCCTACCCAAGGTTTACTCGAGTAAACCTTGGGTAGGAGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206935
ARL9 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 9
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206935.1-163s1c1
Sequence:CCGGGCAGTTCACATCAACTCTGAACTCGAGTTCAGAGTTGATGTGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206935.1-145s1c1
Sequence:CCGGCCTACCCAAGGTTTAAATGCACTCGAGTGCATTTAAACCTTGGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206935.1-57s1c1
Sequence:CCGGGCAGATCCTAGTACTAGGTCTCTCGAGAGACCTAGTACTAGGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206935.1-189s1c1
Sequence:CCGGGCAAATGGAGTTCCTGGAGATCTCGAGATCTCCAGGAACTCCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206935.1-140s1c1
Sequence:CCGGCAGCTCCTACCCAAGGTTTAACTCGAGTTAAACCTTGGGTAGGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206935.1-179s1c1
Sequence:CCGGCTGAAGATAGGCAAATGGAGTCTCGAGACTCCATTTGCCTATCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206935.1-161s21c1
Sequence:GTACCGGATGCAGTTCACATCAACTCTGCTCGAGCAGAGTTGATGTGAACTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206935.1-194s21c1
Sequence:GTACCGGTGGAGTTCCTGGAGATTGGTGCTCGAGCACCAATCTCCAGGAACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206935.1-231s21c1
Sequence:GTACCGGCTCCTACTGGGAGATGTACCTCTCGAGAGGTACATCTCCCAGTAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206935.1-139s21c1
Sequence:GTACCGGACAGCTCCTACCCAAGGTTTACTCGAGTAAACCTTGGGTAGGAGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206935
ARL9 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 9
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206935.1-163s1c1
Sequence:CCGGGCAGTTCACATCAACTCTGAACTCGAGTTCAGAGTTGATGTGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206935.1-145s1c1
Sequence:CCGGCCTACCCAAGGTTTAAATGCACTCGAGTGCATTTAAACCTTGGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206935.1-57s1c1
Sequence:CCGGGCAGATCCTAGTACTAGGTCTCTCGAGAGACCTAGTACTAGGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206935.1-189s1c1
Sequence:CCGGGCAAATGGAGTTCCTGGAGATCTCGAGATCTCCAGGAACTCCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206935.1-140s1c1
Sequence:CCGGCAGCTCCTACCCAAGGTTTAACTCGAGTTAAACCTTGGGTAGGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206935.1-179s1c1
Sequence:CCGGCTGAAGATAGGCAAATGGAGTCTCGAGACTCCATTTGCCTATCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206935.1-161s21c1
Sequence:GTACCGGATGCAGTTCACATCAACTCTGCTCGAGCAGAGTTGATGTGAACTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206935.1-194s21c1
Sequence:GTACCGGTGGAGTTCCTGGAGATTGGTGCTCGAGCACCAATCTCCAGGAACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206935.1-231s21c1
Sequence:GTACCGGCTCCTACTGGGAGATGTACCTCTCGAGAGGTACATCTCCCAGTAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206935.1-139s21c1
Sequence:GTACCGGACAGCTCCTACCCAAGGTTTACTCGAGTAAACCTTGGGTAGGAGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks