EMAIL THIS PAGE TO A FRIEND

ARMC10

armadillo repeat containing 10

90 Gene Product Result for
Synonyms: PNAS-112 PNAS112 SVH
Gene ID:
Human(83787) Summary: This gene encodes a protein that contains an armadillo repeat and transmembrane domain. The encoded protein decreases the transcriptional activity of the tumor suppressor protein p53 through direct interaction with the DNA-binding domain of p53, and may play a role in cell growth and survival. Upregulation of this gene may play a role in hepatocellular carcinoma. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 3. [provided by RefSeq, Sep 2011]
Mouse(67211) armadillo repeat containing 10
Rat(296758) armadillo repeat containing 10
naked mole-rat(101724253) armadillo repeat containing 10
domestic guinea pig(100728237) armadillo repeat containing 10
sheep(101103718) armadillo repeat containing 10
chicken(417720) armadillo repeat containing 10
domestic cat(101086960) armadillo repeat containing 10
cow(100138038) armadillo repeat containing 10
dog(475899) armadillo repeat containing 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031905 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031905 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031905 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026034 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026034 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026034 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031905 Rosetta Predictions human pricing
NM_001106576 Rosetta Predictions rat pricing
NM_026034 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031905 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131147 predicted 1276
2 SASI_Hs01_00131148 predicted 1060
3 SASI_Hs01_00131149 predicted 1295
4 SASI_Hs01_00131150 predicted 987
5 SASI_Hs01_00131151 predicted 1435
6 SASI_Hs02_00359033 predicted 717
7 SASI_Hs01_00131152 predicted 1218
8 SASI_Hs01_00131153 predicted 1315
9 SASI_Hs01_00131154 predicted 999
10 SASI_Hs01_00131155 predicted 1330
11 SASI_Hs01_00131156 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106576 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220318 predicted 1157
2 SASI_Rn02_00220319 predicted 1092
3 SASI_Rn02_00220320 predicted 1034
4 SASI_Rn02_00220321 predicted 1030
5 SASI_Rn02_00220322 predicted 709
6 SASI_Rn02_00220323 predicted 486
7 SASI_Rn02_00220324 predicted 867
8 SASI_Rn02_00220325 predicted 1121
9 SASI_Rn02_00220326 predicted 489
10 SASI_Rn02_00220327 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026034 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155828 predicted 811
2 SASI_Mm01_00155831 predicted 485
3 SASI_Mm02_00329519 predicted 890
4 SASI_Mm02_00329520 predicted 420
5 SASI_Mm02_00329521 predicted 935
6 SASI_Mm02_00329522 predicted 491
7 SASI_Mm02_00329523 predicted 735
8 SASI_Mm02_00329524 predicted 829
9 SASI_Mm02_00329525 predicted 487
10 SASI_Mm02_00329526 predicted 751
11 SASI_Mm01_00155826 predicted 984
12 SASI_Mm01_00155827 predicted 1011
13 SASI_Mm01_00155829 predicted 1015
14 SASI_Mm01_00155830 predicted 1018
15 SASI_Mm01_00155832 predicted 1129
16 SASI_Mm01_00155833 predicted 1128
17 SASI_Mm01_00155834 predicted 967
18 SASI_Mm01_00155835 predicted 1066
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031905
VALIDATED
ARMC10 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing 10
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031905.2-1031s1c1
Sequence:CCGGGCACATGCTTCACAGTTACATCTCGAGATGTAACTGTGAAGCATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031905.2-634s1c1
Sequence:CCGGCTGAAGACTTAACTGATGGTTCTCGAGAACCATCAGTTAAGTCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031905.2-633s1c1
Sequence:CCGGCCTGAAGACTTAACTGATGGTCTCGAGACCATCAGTTAAGTCTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128141    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031905.2-1559s1c1
Sequence:CCGGCCGTGGTTCTCAGATTTATTTCTCGAGAAATAAATCTGAGAACCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031905.2-1206s1c1
Sequence:CCGGGTAGCAAAGGAGATTCTTCTTCTCGAGAAGAAGAATCTCCTTTGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031905.2-1359s1c1
Sequence:CCGGGCTTTAGTTGATCACCATGATCTCGAGATCATGGTGATCAACTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031905.2-2010s1c1
Sequence:CCGGCCATCTTTAGACAGTTGGTTACTCGAGTAACCAACTGTCTAAAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_031905.2-1087s21c1
Sequence:CCGGGAAACACGAAGGTGCAAGTTTCTCGAGAAACTTGCACCTTCGTGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_031905.2-1156s21c1
Sequence:CCGGTTCTCCGTGCCCAAGTGGATTCTCGAGAATCCACTTGGGCACGGAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_031905.2-1164s21c1
Sequence:CCGGGCCCAAGTGGATTCATCATTCCTCGAGGAATGATGAATCCACTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_031905.2-1139s21c1
Sequence:CCGGAGCCATGACAGAAGGACTTCTCTCGAGAGAAGTCCTTCTGTCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031905.2-625s21c1
Sequence:CCGGCCTCGCAGCCTGAAGACTTAACTCGAGTTAAGTCTTCAGGCTGCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031905
VALIDATED
ARMC10 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing 10
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031905.2-1031s1c1
Sequence:CCGGGCACATGCTTCACAGTTACATCTCGAGATGTAACTGTGAAGCATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031905.2-634s1c1
Sequence:CCGGCTGAAGACTTAACTGATGGTTCTCGAGAACCATCAGTTAAGTCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031905.2-633s1c1
Sequence:CCGGCCTGAAGACTTAACTGATGGTCTCGAGACCATCAGTTAAGTCTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128141    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031905.2-1559s1c1
Sequence:CCGGCCGTGGTTCTCAGATTTATTTCTCGAGAAATAAATCTGAGAACCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031905.2-1206s1c1
Sequence:CCGGGTAGCAAAGGAGATTCTTCTTCTCGAGAAGAAGAATCTCCTTTGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031905.2-1359s1c1
Sequence:CCGGGCTTTAGTTGATCACCATGATCTCGAGATCATGGTGATCAACTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031905.2-2010s1c1
Sequence:CCGGCCATCTTTAGACAGTTGGTTACTCGAGTAACCAACTGTCTAAAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_031905.2-1087s21c1
Sequence:CCGGGAAACACGAAGGTGCAAGTTTCTCGAGAAACTTGCACCTTCGTGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_031905.2-1156s21c1
Sequence:CCGGTTCTCCGTGCCCAAGTGGATTCTCGAGAATCCACTTGGGCACGGAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_031905.2-1164s21c1
Sequence:CCGGGCCCAAGTGGATTCATCATTCCTCGAGGAATGATGAATCCACTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_031905.2-1139s21c1
Sequence:CCGGAGCCATGACAGAAGGACTTCTCTCGAGAGAAGTCCTTCTGTCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031905.2-625s21c1
Sequence:CCGGCCTCGCAGCCTGAAGACTTAACTCGAGTTAAGTCTTCAGGCTGCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031905
VALIDATED
ARMC10 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing 10
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031905.2-1031s1c1
Sequence:CCGGGCACATGCTTCACAGTTACATCTCGAGATGTAACTGTGAAGCATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031905.2-634s1c1
Sequence:CCGGCTGAAGACTTAACTGATGGTTCTCGAGAACCATCAGTTAAGTCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031905.2-633s1c1
Sequence:CCGGCCTGAAGACTTAACTGATGGTCTCGAGACCATCAGTTAAGTCTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128141    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031905.2-1559s1c1
Sequence:CCGGCCGTGGTTCTCAGATTTATTTCTCGAGAAATAAATCTGAGAACCACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031905.2-1206s1c1
Sequence:CCGGGTAGCAAAGGAGATTCTTCTTCTCGAGAAGAAGAATCTCCTTTGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031905.2-1359s1c1
Sequence:CCGGGCTTTAGTTGATCACCATGATCTCGAGATCATGGTGATCAACTAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031905.2-2010s1c1
Sequence:CCGGCCATCTTTAGACAGTTGGTTACTCGAGTAACCAACTGTCTAAAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_031905.2-1087s21c1
Sequence:CCGGGAAACACGAAGGTGCAAGTTTCTCGAGAAACTTGCACCTTCGTGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_031905.2-1156s21c1
Sequence:CCGGTTCTCCGTGCCCAAGTGGATTCTCGAGAATCCACTTGGGCACGGAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_031905.2-1164s21c1
Sequence:CCGGGCCCAAGTGGATTCATCATTCCTCGAGGAATGATGAATCCACTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_031905.2-1139s21c1
Sequence:CCGGAGCCATGACAGAAGGACTTCTCTCGAGAGAAGTCCTTCTGTCATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031905.2-625s21c1
Sequence:CCGGCCTCGCAGCCTGAAGACTTAACTCGAGTTAAGTCTTCAGGCTGCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026034
VALIDATED
ARMC10 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing 10
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026034.1-830s1c1
Sequence:CCGGGAGATTCTTCTTCGGGCTCTTCTCGAGAAGAGCCCGAAGAAGAATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026034.1-818s1c1
Sequence:CCGGCAAGTAGCAAATGAGATTCTTCTCGAGAAGAATCTCATTTGCTACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026034.1-327s1c1
Sequence:CCGGCAACCGACGATCCTGTCATTACTCGAGTAATGACAGGATCGTCGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026034.1-1013s1c1
Sequence:CCGGGCTTTAGCAATAAAGCCGAAACTCGAGTTTCGGCTTTATTGCTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026034.1-267s1c1
Sequence:CCGGGCTCCTATGACGATATCTTAACTCGAGTTAAGATATCGTCATAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200327    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026034.1-1310s1c1
Sequence:CCGGGCCATGCTCTTCAGGACTATTCTCGAGAATAGTCCTGAAGAGCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026034.1-262s1c1
Sequence:CCGGCGATGGCTCCTATGACGATATCTCGAGATATCGTCATAGGAGCCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026034.4-1253s21c1
Sequence:CCGGTTCCGAGGATGTGGATCATTTCTCGAGAAATGATCCACATCCTCGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026034.4-1036s21c1
Sequence:CCGGTCTGATCGGTTGCTCCTATTTCTCGAGAAATAGGAGCAACCGATCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026034.4-390s21c1
Sequence:CCGGTCCACTAACCAGGCCATTATTCTCGAGAATAATGGCCTGGTTAGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026034.4-625s21c1
Sequence:CCGGTGACGGTCACCAACGACTATCCTCGAGGATAGTCGTTGGTGACCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026034.4-885s21c1
Sequence:CCGGGTGGAAGGCCGGTTAGCTAATCTCGAGATTAGCTAACCGGCCTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026034
VALIDATED
ARMC10 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing 10
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026034.1-830s1c1
Sequence:CCGGGAGATTCTTCTTCGGGCTCTTCTCGAGAAGAGCCCGAAGAAGAATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026034.1-818s1c1
Sequence:CCGGCAAGTAGCAAATGAGATTCTTCTCGAGAAGAATCTCATTTGCTACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026034.1-327s1c1
Sequence:CCGGCAACCGACGATCCTGTCATTACTCGAGTAATGACAGGATCGTCGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026034.1-1013s1c1
Sequence:CCGGGCTTTAGCAATAAAGCCGAAACTCGAGTTTCGGCTTTATTGCTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026034.1-267s1c1
Sequence:CCGGGCTCCTATGACGATATCTTAACTCGAGTTAAGATATCGTCATAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200327    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026034.1-1310s1c1
Sequence:CCGGGCCATGCTCTTCAGGACTATTCTCGAGAATAGTCCTGAAGAGCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026034.1-262s1c1
Sequence:CCGGCGATGGCTCCTATGACGATATCTCGAGATATCGTCATAGGAGCCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026034.4-1253s21c1
Sequence:CCGGTTCCGAGGATGTGGATCATTTCTCGAGAAATGATCCACATCCTCGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026034.4-1036s21c1
Sequence:CCGGTCTGATCGGTTGCTCCTATTTCTCGAGAAATAGGAGCAACCGATCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026034.4-390s21c1
Sequence:CCGGTCCACTAACCAGGCCATTATTCTCGAGAATAATGGCCTGGTTAGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026034.4-625s21c1
Sequence:CCGGTGACGGTCACCAACGACTATCCTCGAGGATAGTCGTTGGTGACCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026034.4-885s21c1
Sequence:CCGGGTGGAAGGCCGGTTAGCTAATCTCGAGATTAGCTAACCGGCCTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026034
VALIDATED
ARMC10 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing 10
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026034.1-830s1c1
Sequence:CCGGGAGATTCTTCTTCGGGCTCTTCTCGAGAAGAGCCCGAAGAAGAATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026034.1-818s1c1
Sequence:CCGGCAAGTAGCAAATGAGATTCTTCTCGAGAAGAATCTCATTTGCTACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026034.1-327s1c1
Sequence:CCGGCAACCGACGATCCTGTCATTACTCGAGTAATGACAGGATCGTCGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026034.1-1013s1c1
Sequence:CCGGGCTTTAGCAATAAAGCCGAAACTCGAGTTTCGGCTTTATTGCTAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026034.1-267s1c1
Sequence:CCGGGCTCCTATGACGATATCTTAACTCGAGTTAAGATATCGTCATAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200327    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026034.1-1310s1c1
Sequence:CCGGGCCATGCTCTTCAGGACTATTCTCGAGAATAGTCCTGAAGAGCATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026034.1-262s1c1
Sequence:CCGGCGATGGCTCCTATGACGATATCTCGAGATATCGTCATAGGAGCCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026034.4-1253s21c1
Sequence:CCGGTTCCGAGGATGTGGATCATTTCTCGAGAAATGATCCACATCCTCGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026034.4-1036s21c1
Sequence:CCGGTCTGATCGGTTGCTCCTATTTCTCGAGAAATAGGAGCAACCGATCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026034.4-390s21c1
Sequence:CCGGTCCACTAACCAGGCCATTATTCTCGAGAATAATGGCCTGGTTAGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026034.4-625s21c1
Sequence:CCGGTGACGGTCACCAACGACTATCCTCGAGGATAGTCGTTGGTGACCGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026034.4-885s21c1
Sequence:CCGGGTGGAAGGCCGGTTAGCTAATCTCGAGATTAGCTAACCGGCCTTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)