EMAIL THIS PAGE TO A FRIEND

ARMC12

armadillo repeat containing 12

43 Gene Product Result for
Synonyms: C6orf81
UniProtKB ID: Q5T9G4, Q8NEB2, Q96LL8
Gene ID:
Mouse(67645) armadillo repeat containing 12
Rat(294301) armadillo repeat containing 12
dog(474886) armadillo repeat containing 12
cow(540812) armadillo repeat containing 12
domestic cat(101099963) armadillo repeat containing 12
sheep(101118823) armadillo repeat containing 12
domestic guinea pig(100730656) armadillo repeat containing 12
naked mole-rat(101719935) armadillo repeat containing 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1103423 Anti-C6orf81 (281-295) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026290 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026290 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026290 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145028 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145028 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145028 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU034281 MISSION® esiRNA esiRNA human C6orf81 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145028 Rosetta Predictions human pricing
NM_001113777 Rosetta Predictions rat pricing
NM_026290 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145028 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364892 predicted 829
2 SASI_Hs01_00228955 predicted 545
3 SASI_Hs01_00228956 predicted 449
4 SASI_Hs01_00228957 predicted 359
5 SASI_Hs01_00228958 predicted 839
6 SASI_Hs01_00228959 predicted 559
7 SASI_Hs01_00228960 predicted 698
8 SASI_Hs01_00228962 predicted 491
9 SASI_Hs01_00228963 predicted 578
10 SASI_Hs02_00364893 predicted 645
11 SASI_Hs01_00228961 predicted 911
12 SASI_Hs01_00228964 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113777 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252033 predicted 577
2 SASI_Rn02_00252034 predicted 931
3 SASI_Rn02_00252035 predicted 320
4 SASI_Rn02_00252036 predicted 663
5 SASI_Rn02_00252037 predicted 634
6 SASI_Rn02_00252038 predicted 540
7 SASI_Rn02_00252039 predicted 424
8 SASI_Rn02_00252040 predicted 434
9 SASI_Rn02_00252041 predicted 232
10 SASI_Rn02_00252042 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026290 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053242 predicted 561
2 SASI_Mm01_00053243 predicted 952
3 SASI_Mm01_00053244 predicted 668
4 SASI_Mm01_00053245 predicted 238
5 SASI_Mm01_00053246 predicted 772
6 SASI_Mm01_00053247 predicted 278
7 SASI_Mm01_00053248 predicted 474
8 SASI_Mm01_00053249 predicted 251
9 SASI_Mm01_00053250 predicted 226
10 SASI_Mm01_00053251 predicted 651
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026290
ARMC12 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing 12
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026290.2-824s21c1
Sequence:CCGGCCGAGCGGTCAAATGGCATTACTCGAGTAATGCCATTTGACCGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026290.2-1045s1c1
Sequence:CCGGGAAGTTAAGGAGATCCAATAACTCGAGTTATTGGATCTCCTTAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026290.2-257s1c1
Sequence:CCGGCTGCAAACAGGATGAGTATACCTCGAGGTATACTCATCCTGTTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026290.2-682s21c1
Sequence:CCGGACGACCTTCTTTATGACATTCCTCGAGGAATGTCATAAAGAAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026290.2-1047s21c1
Sequence:CCGGAGTTAAGGAGATCCAATAAATCTCGAGATTTATTGGATCTCCTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026290.2-478s21c1
Sequence:CCGGTCAAGGTACTGGAACTGATTTCTCGAGAAATCAGTTCCAGTACCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026290.2-257s21c1
Sequence:CCGGCTGCAAACAGGATGAGTATACCTCGAGGTATACTCATCCTGTTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026290.1-470s1c1
Sequence:CCGGGCATTGCATCAAGGTACTGGACTCGAGTCCAGTACCTTGATGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026290.1-471s1c1
Sequence:CCGGCATTGCATCAAGGTACTGGAACTCGAGTTCCAGTACCTTGATGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026290.1-407s1c1
Sequence:CCGGCCAAGCTCTGAATGCACTTAACTCGAGTTAAGTGCATTCAGAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026290
ARMC12 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing 12
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026290.2-824s21c1
Sequence:CCGGCCGAGCGGTCAAATGGCATTACTCGAGTAATGCCATTTGACCGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026290.2-1045s1c1
Sequence:CCGGGAAGTTAAGGAGATCCAATAACTCGAGTTATTGGATCTCCTTAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026290.2-257s1c1
Sequence:CCGGCTGCAAACAGGATGAGTATACCTCGAGGTATACTCATCCTGTTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026290.2-682s21c1
Sequence:CCGGACGACCTTCTTTATGACATTCCTCGAGGAATGTCATAAAGAAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026290.2-1047s21c1
Sequence:CCGGAGTTAAGGAGATCCAATAAATCTCGAGATTTATTGGATCTCCTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026290.2-478s21c1
Sequence:CCGGTCAAGGTACTGGAACTGATTTCTCGAGAAATCAGTTCCAGTACCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026290.2-257s21c1
Sequence:CCGGCTGCAAACAGGATGAGTATACCTCGAGGTATACTCATCCTGTTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026290.1-470s1c1
Sequence:CCGGGCATTGCATCAAGGTACTGGACTCGAGTCCAGTACCTTGATGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026290.1-471s1c1
Sequence:CCGGCATTGCATCAAGGTACTGGAACTCGAGTTCCAGTACCTTGATGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026290.1-407s1c1
Sequence:CCGGCCAAGCTCTGAATGCACTTAACTCGAGTTAAGTGCATTCAGAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026290
ARMC12 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing 12
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026290.2-824s21c1
Sequence:CCGGCCGAGCGGTCAAATGGCATTACTCGAGTAATGCCATTTGACCGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026290.2-1045s1c1
Sequence:CCGGGAAGTTAAGGAGATCCAATAACTCGAGTTATTGGATCTCCTTAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026290.2-257s1c1
Sequence:CCGGCTGCAAACAGGATGAGTATACCTCGAGGTATACTCATCCTGTTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026290.2-682s21c1
Sequence:CCGGACGACCTTCTTTATGACATTCCTCGAGGAATGTCATAAAGAAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026290.2-1047s21c1
Sequence:CCGGAGTTAAGGAGATCCAATAAATCTCGAGATTTATTGGATCTCCTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026290.2-478s21c1
Sequence:CCGGTCAAGGTACTGGAACTGATTTCTCGAGAAATCAGTTCCAGTACCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026290.2-257s21c1
Sequence:CCGGCTGCAAACAGGATGAGTATACCTCGAGGTATACTCATCCTGTTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026290.1-470s1c1
Sequence:CCGGGCATTGCATCAAGGTACTGGACTCGAGTCCAGTACCTTGATGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026290.1-471s1c1
Sequence:CCGGCATTGCATCAAGGTACTGGAACTCGAGTTCCAGTACCTTGATGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026290.1-407s1c1
Sequence:CCGGCCAAGCTCTGAATGCACTTAACTCGAGTTAAGTGCATTCAGAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145028
ARMC12 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing 12
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145028.3-492s21c1
Sequence:CCGGCCAAGCTCTGAATACACTTAACTCGAGTTAAGTGTATTCAGAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145028.3-909s21c1
Sequence:CCGGCCACGTGGTGAAATGGCATTACTCGAGTAATGCCATTTCACCACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145028.3-126s21c1
Sequence:CCGGGGCCATCAAGGCTGGCATAAACTCGAGTTTATGCCAGCCTTGATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145028.3-767s21c1
Sequence:CCGGATGACCTTCTCTATGACATTCCTCGAGGAATGTCATAGAGAAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145028.3-798s21c1
Sequence:CCGGGGTTCACTCCAACTTCCTAAACTCGAGTTTAGGAAGTTGGAGTGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145028.3-381s1c1
Sequence:CCGGCAGTATCACTCGCTGTGTGTACTCGAGTACACACAGCGAGTGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145028
ARMC12 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing 12
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145028.3-492s21c1
Sequence:CCGGCCAAGCTCTGAATACACTTAACTCGAGTTAAGTGTATTCAGAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145028.3-909s21c1
Sequence:CCGGCCACGTGGTGAAATGGCATTACTCGAGTAATGCCATTTCACCACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145028.3-126s21c1
Sequence:CCGGGGCCATCAAGGCTGGCATAAACTCGAGTTTATGCCAGCCTTGATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145028.3-767s21c1
Sequence:CCGGATGACCTTCTCTATGACATTCCTCGAGGAATGTCATAGAGAAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145028.3-798s21c1
Sequence:CCGGGGTTCACTCCAACTTCCTAAACTCGAGTTTAGGAAGTTGGAGTGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145028.3-381s1c1
Sequence:CCGGCAGTATCACTCGCTGTGTGTACTCGAGTACACACAGCGAGTGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145028
ARMC12 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing 12
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145028.3-492s21c1
Sequence:CCGGCCAAGCTCTGAATACACTTAACTCGAGTTAAGTGTATTCAGAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145028.3-909s21c1
Sequence:CCGGCCACGTGGTGAAATGGCATTACTCGAGTAATGCCATTTCACCACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145028.3-126s21c1
Sequence:CCGGGGCCATCAAGGCTGGCATAAACTCGAGTTTATGCCAGCCTTGATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145028.3-767s21c1
Sequence:CCGGATGACCTTCTCTATGACATTCCTCGAGGAATGTCATAGAGAAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145028.3-798s21c1
Sequence:CCGGGGTTCACTCCAACTTCCTAAACTCGAGTTTAGGAAGTTGGAGTGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145028.3-381s1c1
Sequence:CCGGCAGTATCACTCGCTGTGTGTACTCGAGTACACACAGCGAGTGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks