EMAIL THIS PAGE TO A FRIEND

ARMC1

armadillo repeat containing 1

Synonyms: Arcp
UniProtKB ID: Q9NVT9, Q9H018, Q9H820
Gene ID:
Mouse(74252) armadillo repeat containing 1
Rat(294948) armadillo repeat containing 1
Zebrafish(494066) armadillo repeat containing 1
cow(514000) armadillo repeat containing 1
domestic cat(101087638) armadillo repeat containing 1
dog(486974) armadillo repeat containing 1
chicken(429406) armadillo repeat containing 1
sheep(101119911) armadillo repeat containing 1
domestic guinea pig(100721034) armadillo repeat containing 1
naked mole-rat(101720620) armadillo repeat containing 1
104 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018120 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018120 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018120 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028840 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028840 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028840 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018120 Rosetta Predictions human pricing
NM_001106425 Rosetta Predictions rat pricing
NM_028840 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018120 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165231 predicted 1154
2 SASI_Hs01_00165232 predicted 404
3 SASI_Hs01_00165233 predicted 1145
4 SASI_Hs01_00165234 predicted 469
5 SASI_Hs01_00165235 predicted 287
6 SASI_Hs01_00165236 predicted 270
7 SASI_Hs02_00351329 predicted 566
8 SASI_Hs01_00165238 predicted 292
9 SASI_Hs01_00165239 predicted 690
10 SASI_Hs01_00165240 predicted 253
11 SASI_Hs01_00165237 predicted 896
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106425 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218838 predicted 658
2 SASI_Rn02_00218839 predicted 1125
3 SASI_Rn02_00218840 predicted 1160
4 SASI_Rn02_00218841 predicted 666
5 SASI_Rn02_00218842 predicted 577
6 SASI_Rn02_00218843 predicted 824
7 SASI_Rn02_00218844 predicted 1116
8 SASI_Rn02_00218845 predicted 1009
9 SASI_Rn02_00218846 predicted 1136
10 SASI_Rn02_00218847 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028840 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334490 predicted 1325
2 SASI_Mm01_00092767 predicted 1110
3 SASI_Mm01_00092768 predicted 1008
4 SASI_Mm01_00092769 predicted 813
5 SASI_Mm01_00092770 predicted 1173
6 SASI_Mm01_00092771 predicted 1126
7 SASI_Mm01_00092772 predicted 1216
8 SASI_Mm01_00092773 predicted 261
9 SASI_Mm01_00092774 predicted 1150
10 SASI_Mm01_00092775 predicted 1065
11 SASI_Mm01_00092776 predicted 278
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018120
VALIDATED
ARMC1 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018120.3-271s21c1
Sequence:CCGGTGACGCTCTATCGGTAGTTAACTCGAGTTAACTACCGATAGAGCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279612    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018120.3-1190s21c1
Sequence:CCGGTTAGATTACACGATCGCATATCTCGAGATATGCGATCGTGTAATCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018120.3-890s21c1
Sequence:CCGGGAGATGTTGGTCCCATTCCAACTCGAGTTGGAATGGGACCAACATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018120.3-304s21c1
Sequence:CCGGTCTAGCAGCAGATCCGTTAAACTCGAGTTTAACGGATCTGCTGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018120.3-692s21c1
Sequence:CCGGGATGATACGTCTCGGAGAAATCTCGAGATTTCTCCGAGACGTATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018120.3-890s1c1
Sequence:CCGGGAGATGTTGGTCCCATTCCAACTCGAGTTGGAATGGGACCAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018120.3-1533s1c1
Sequence:CCGGGCTTTGTACTCTTCACTGAAACTCGAGTTTCAGTGAAGAGTACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018120.3-831s1c1
Sequence:CCGGCAATAGCATCAACCAAGGTTACTCGAGTAACCTTGGTTGATGCTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018120.3-287s1c1
Sequence:CCGGGTTAACCAGTTACGGGATCTACTCGAGTAGATCCCGTAACTGGTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018120.3-614s1c1
Sequence:CCGGCGTCGAAGGAAAGCTCAATTTCTCGAGAAATTGAGCTTTCCTTCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018120.3-1603s1c1
Sequence:CCGGCCGTGTTTATAGAAAGGACATCTCGAGATGTCCTTTCTATAAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018120.3-1473s1c1
Sequence:CCGGGCTCAAGTTGTGCATGAATTACTCGAGTAATTCATGCACAACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018120
VALIDATED
ARMC1 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018120.3-271s21c1
Sequence:CCGGTGACGCTCTATCGGTAGTTAACTCGAGTTAACTACCGATAGAGCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279612    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018120.3-1190s21c1
Sequence:CCGGTTAGATTACACGATCGCATATCTCGAGATATGCGATCGTGTAATCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018120.3-890s21c1
Sequence:CCGGGAGATGTTGGTCCCATTCCAACTCGAGTTGGAATGGGACCAACATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018120.3-304s21c1
Sequence:CCGGTCTAGCAGCAGATCCGTTAAACTCGAGTTTAACGGATCTGCTGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018120.3-692s21c1
Sequence:CCGGGATGATACGTCTCGGAGAAATCTCGAGATTTCTCCGAGACGTATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018120.3-890s1c1
Sequence:CCGGGAGATGTTGGTCCCATTCCAACTCGAGTTGGAATGGGACCAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018120.3-1533s1c1
Sequence:CCGGGCTTTGTACTCTTCACTGAAACTCGAGTTTCAGTGAAGAGTACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018120.3-831s1c1
Sequence:CCGGCAATAGCATCAACCAAGGTTACTCGAGTAACCTTGGTTGATGCTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018120.3-287s1c1
Sequence:CCGGGTTAACCAGTTACGGGATCTACTCGAGTAGATCCCGTAACTGGTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018120.3-614s1c1
Sequence:CCGGCGTCGAAGGAAAGCTCAATTTCTCGAGAAATTGAGCTTTCCTTCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018120.3-1603s1c1
Sequence:CCGGCCGTGTTTATAGAAAGGACATCTCGAGATGTCCTTTCTATAAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018120.3-1473s1c1
Sequence:CCGGGCTCAAGTTGTGCATGAATTACTCGAGTAATTCATGCACAACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018120
VALIDATED
ARMC1 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018120.3-271s21c1
Sequence:CCGGTGACGCTCTATCGGTAGTTAACTCGAGTTAACTACCGATAGAGCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279612    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018120.3-1190s21c1
Sequence:CCGGTTAGATTACACGATCGCATATCTCGAGATATGCGATCGTGTAATCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018120.3-890s21c1
Sequence:CCGGGAGATGTTGGTCCCATTCCAACTCGAGTTGGAATGGGACCAACATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018120.3-304s21c1
Sequence:CCGGTCTAGCAGCAGATCCGTTAAACTCGAGTTTAACGGATCTGCTGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018120.3-692s21c1
Sequence:CCGGGATGATACGTCTCGGAGAAATCTCGAGATTTCTCCGAGACGTATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018120.3-890s1c1
Sequence:CCGGGAGATGTTGGTCCCATTCCAACTCGAGTTGGAATGGGACCAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018120.3-1533s1c1
Sequence:CCGGGCTTTGTACTCTTCACTGAAACTCGAGTTTCAGTGAAGAGTACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018120.3-831s1c1
Sequence:CCGGCAATAGCATCAACCAAGGTTACTCGAGTAACCTTGGTTGATGCTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018120.3-287s1c1
Sequence:CCGGGTTAACCAGTTACGGGATCTACTCGAGTAGATCCCGTAACTGGTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018120.3-614s1c1
Sequence:CCGGCGTCGAAGGAAAGCTCAATTTCTCGAGAAATTGAGCTTTCCTTCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018120.3-1603s1c1
Sequence:CCGGCCGTGTTTATAGAAAGGACATCTCGAGATGTCCTTTCTATAAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018120.3-1473s1c1
Sequence:CCGGGCTCAAGTTGTGCATGAATTACTCGAGTAATTCATGCACAACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028840
VALIDATED
ARMC1 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028840.2-648s21c1
Sequence:CCGGCATAGATGGTCTCGATGATACCTCGAGGTATCATCGAGACCATCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028840.2-256s21c1
Sequence:CCGGGTTAACCAGCTACGGGATTTACTCGAGTAAATCCCGTAGCTGGTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028840.2-648s1c1
Sequence:CCGGCATAGATGGTCTCGATGATACCTCGAGGTATCATCGAGACCATCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028840.2-528s21c1
Sequence:CCGGCATCCTTCAATCCTCCAATTTCTCGAGAAATTGGAGGATTGAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028840.2-401s21c1
Sequence:CCGGTGGCTGAATGCCGTGCGAATACTCGAGTATTCGCACGGCATTCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028840.2-517s1c1
Sequence:CCGGGAAATCTATGACATCCTTCAACTCGAGTTGAAGGATGTCATAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028840.2-795s1c1
Sequence:CCGGGTCAGCAATAGCATCAACCAACTCGAGTTGGTTGATGCTATTGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190796    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028840.2-2626s1c1
Sequence:CCGGGCACATCTCTAAGCTGTGTAACTCGAGTTACACAGCTTAGAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028840
VALIDATED
ARMC1 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028840.2-648s21c1
Sequence:CCGGCATAGATGGTCTCGATGATACCTCGAGGTATCATCGAGACCATCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028840.2-256s21c1
Sequence:CCGGGTTAACCAGCTACGGGATTTACTCGAGTAAATCCCGTAGCTGGTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028840.2-648s1c1
Sequence:CCGGCATAGATGGTCTCGATGATACCTCGAGGTATCATCGAGACCATCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028840.2-528s21c1
Sequence:CCGGCATCCTTCAATCCTCCAATTTCTCGAGAAATTGGAGGATTGAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028840.2-401s21c1
Sequence:CCGGTGGCTGAATGCCGTGCGAATACTCGAGTATTCGCACGGCATTCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028840.2-517s1c1
Sequence:CCGGGAAATCTATGACATCCTTCAACTCGAGTTGAAGGATGTCATAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028840.2-795s1c1
Sequence:CCGGGTCAGCAATAGCATCAACCAACTCGAGTTGGTTGATGCTATTGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190796    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028840.2-2626s1c1
Sequence:CCGGGCACATCTCTAAGCTGTGTAACTCGAGTTACACAGCTTAGAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028840
VALIDATED
ARMC1 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028840.2-648s21c1
Sequence:CCGGCATAGATGGTCTCGATGATACCTCGAGGTATCATCGAGACCATCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028840.2-256s21c1
Sequence:CCGGGTTAACCAGCTACGGGATTTACTCGAGTAAATCCCGTAGCTGGTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028840.2-648s1c1
Sequence:CCGGCATAGATGGTCTCGATGATACCTCGAGGTATCATCGAGACCATCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028840.2-528s21c1
Sequence:CCGGCATCCTTCAATCCTCCAATTTCTCGAGAAATTGGAGGATTGAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028840.2-401s21c1
Sequence:CCGGTGGCTGAATGCCGTGCGAATACTCGAGTATTCGCACGGCATTCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028840.2-517s1c1
Sequence:CCGGGAAATCTATGACATCCTTCAACTCGAGTTGAAGGATGTCATAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028840.2-795s1c1
Sequence:CCGGGTCAGCAATAGCATCAACCAACTCGAGTTGGTTGATGCTATTGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190796    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028840.2-2626s1c1
Sequence:CCGGGCACATCTCTAAGCTGTGTAACTCGAGTTACACAGCTTAGAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks