EMAIL THIS PAGE TO A FRIEND

ARMC2

armadillo repeat containing 2

Synonyms: bA787I22.1
UniProtKB ID: Q8NEN0, A8K8Y4, Q5VVY8, Q9H0K9
Gene ID:
Mouse(213402) armadillo repeat containing 2
Rat(499470) armadillo repeat containing 2
Zebrafish(555846) armadillo repeat containing 2
chicken(421767) armadillo repeat containing 2
domestic cat(101099127) armadillo repeat containing 2
cow(520151) armadillo repeat containing 2
dog(481955) armadillo repeat containing 2
naked mole-rat(101698010) armadillo repeat containing 2
domestic guinea pig(100729519) armadillo repeat containing 2
sheep(101116405) armadillo repeat containing 2
Domestic Rabbit(100345596) armadillo repeat containing 2
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032131 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032131 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032131 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001034858 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001034858 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001034858 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032131 Rosetta Predictions human pricing
XM_001069261 Rosetta Predictions rat pricing
XM_574794 Rosetta Predictions rat pricing
NM_001034858 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032131 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059756 predicted 1329
2 SASI_Hs01_00059757 predicted 2085
3 SASI_Hs01_00059758 predicted 2200
4 SASI_Hs01_00059759 predicted 807
5 SASI_Hs01_00059760 predicted 2212
6 SASI_Hs01_00059761 predicted 2458
7 SASI_Hs02_00359353 predicted 1865
8 SASI_Hs01_00059763 predicted 2774
9 SASI_Hs01_00059764 predicted 1288
10 SASI_Hs02_00359354 predicted 2399
11 SASI_Hs01_00059762 predicted 1635
12 SASI_Hs01_00059765 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069261 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327420 predicted 1485
2 SASI_Rn02_00327421 predicted 1928
3 SASI_Rn02_00327422 predicted 1238
4 SASI_Rn02_00327423 predicted 2118
5 SASI_Rn02_00327424 predicted 1140
6 SASI_Rn02_00327425 predicted 2014
7 SASI_Rn02_00327426 predicted 1559
8 SASI_Rn02_00327427 predicted 1329
9 SASI_Rn02_00327428 predicted 2180
10 SASI_Rn02_00327429 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574794 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402642 predicted 210
2 SASI_Rn02_00402643 predicted 279
3 SASI_Rn02_00402644 predicted 296
4 SASI_Rn02_00402645 predicted 276
5 SASI_Rn02_00402646 predicted 363
6 SASI_Rn02_00402647 predicted 227
7 SASI_Rn02_00402648 predicted 246
8 SASI_Rn02_00402649 predicted 279
9 SASI_Rn02_00402650 predicted 251
10 SASI_Rn02_00402651 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034858 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198094 predicted 1119
2 SASI_Mm02_00289107 predicted 737
3 SASI_Mm01_00198097 predicted 2224
4 SASI_Mm01_00198098 predicted 1317
5 SASI_Mm01_00198099 predicted 1240
6 SASI_Mm01_00198101 predicted 1785
7 SASI_Mm02_00289108 predicted 232
8 SASI_Mm01_00198102 predicted 1842
9 SASI_Mm01_00198103 predicted 1522
10 SASI_Mm02_00289109 predicted 2633
11 SASI_Mm01_00198095 predicted 1551
12 SASI_Mm01_00198096 predicted 1801
13 SASI_Mm01_00198100 predicted 2492
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032131
ARMC2 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032131.3-2828s1c1
Sequence:CCGGCTGGTAACAAACGTGAACATTCTCGAGAATGTTCACGTTTGTTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032131.3-1329s1c1
Sequence:CCGGGCAAACTAACATGGAAGCTTTCTCGAGAAAGCTTCCATGTTAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032131.3-2572s1c1
Sequence:CCGGGAAGACACCAACACACTCTTACTCGAGTAAGAGTGTGTTGGTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128167    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032131.3-2813s1c1
Sequence:CCGGCCTCATTCTTAAGAACTGGTACTCGAGTACCAGTTCTTAAGAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032131.3-1853s1c1
Sequence:CCGGGCATCCAAACTCTGCTGTCATCTCGAGATGACAGCAGAGTTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032131
ARMC2 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032131.3-2828s1c1
Sequence:CCGGCTGGTAACAAACGTGAACATTCTCGAGAATGTTCACGTTTGTTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032131.3-1329s1c1
Sequence:CCGGGCAAACTAACATGGAAGCTTTCTCGAGAAAGCTTCCATGTTAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032131.3-2572s1c1
Sequence:CCGGGAAGACACCAACACACTCTTACTCGAGTAAGAGTGTGTTGGTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128167    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032131.3-2813s1c1
Sequence:CCGGCCTCATTCTTAAGAACTGGTACTCGAGTACCAGTTCTTAAGAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032131.3-1853s1c1
Sequence:CCGGGCATCCAAACTCTGCTGTCATCTCGAGATGACAGCAGAGTTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032131
ARMC2 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032131.3-2828s1c1
Sequence:CCGGCTGGTAACAAACGTGAACATTCTCGAGAATGTTCACGTTTGTTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032131.3-1329s1c1
Sequence:CCGGGCAAACTAACATGGAAGCTTTCTCGAGAAAGCTTCCATGTTAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032131.3-2572s1c1
Sequence:CCGGGAAGACACCAACACACTCTTACTCGAGTAAGAGTGTGTTGGTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128167    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032131.3-2813s1c1
Sequence:CCGGCCTCATTCTTAAGAACTGGTACTCGAGTACCAGTTCTTAAGAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032131.3-1853s1c1
Sequence:CCGGGCATCCAAACTCTGCTGTCATCTCGAGATGACAGCAGAGTTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001034858
ARMC2 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034858.3-1259s21c1
Sequence:CCGGACGTCTGCAAACTGATATTTACTCGAGTAAATATCAGTTTGCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034858.3-2611s21c1
Sequence:CCGGCTCATCCTCTTGTCGACATTTCTCGAGAAATGTCGACAAGAGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034858.3-2276s21c1
Sequence:CCGGCTGTGCGAGTCTTCGGAAATCCTCGAGGATTTCCGAAGACTCGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034858.3-3998s21c1
Sequence:CCGGAGAGTACACAGTTAGCTATAACTCGAGTTATAGCTAACTGTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034858.3-1802s21c1
Sequence:CCGGAGGACTTAGTAATTCGAATTGCTCGAGCAATTCGAATTACTAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001034858
ARMC2 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034858.3-1259s21c1
Sequence:CCGGACGTCTGCAAACTGATATTTACTCGAGTAAATATCAGTTTGCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034858.3-2611s21c1
Sequence:CCGGCTCATCCTCTTGTCGACATTTCTCGAGAAATGTCGACAAGAGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034858.3-2276s21c1
Sequence:CCGGCTGTGCGAGTCTTCGGAAATCCTCGAGGATTTCCGAAGACTCGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034858.3-3998s21c1
Sequence:CCGGAGAGTACACAGTTAGCTATAACTCGAGTTATAGCTAACTGTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034858.3-1802s21c1
Sequence:CCGGAGGACTTAGTAATTCGAATTGCTCGAGCAATTCGAATTACTAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001034858
ARMC2 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034858.3-1259s21c1
Sequence:CCGGACGTCTGCAAACTGATATTTACTCGAGTAAATATCAGTTTGCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034858.3-2611s21c1
Sequence:CCGGCTCATCCTCTTGTCGACATTTCTCGAGAAATGTCGACAAGAGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034858.3-2276s21c1
Sequence:CCGGCTGTGCGAGTCTTCGGAAATCCTCGAGGATTTCCGAAGACTCGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034858.3-3998s21c1
Sequence:CCGGAGAGTACACAGTTAGCTATAACTCGAGTTATAGCTAACTGTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034858.3-1802s21c1
Sequence:CCGGAGGACTTAGTAATTCGAATTGCTCGAGCAATTCGAATTACTAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks