EMAIL THIS PAGE TO A FRIEND

ARMC3

armadillo repeat containing 3

58 Gene Product Result for
Synonyms: CT81 KU-CT-1
Gene ID:
Human(219681) Summary: Armadillo/beta-catenin (CTNNB1; MIM 116806)-like (ARM) domains are imperfect 45-amino acid repeats involved in protein-protein interactions. ARM domain-containing proteins, such as ARMC3, function in signal transduction, development, cell adhesion and mobility, and tumor initiation and metastasis (Li et al., 2006 [PubMed 16915934]
Mouse(70882) armadillo repeat containing 3
Rat(307156) armadillo repeat containing 3
Rat(100361506) armadillo repeat containing 3
Zebrafish(560136) armadillo repeat containing 3
chicken(420503) armadillo repeat containing 3
domestic cat(101096817) armadillo repeat containing 3
Horse(100066680) armadillo repeat containing 3
cow(525665) armadillo repeat containing 3
dog(477980) armadillo repeat containing 3
sheep(101104515) armadillo repeat containing 3
domestic guinea pig(100717720) armadillo repeat containing 3
naked mole-rat(101704276) armadillo repeat containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173081 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173081 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173081 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081083 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081083 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081083 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173081 Rosetta Predictions human pricing
XM_225610 Rosetta Predictions rat pricing
NM_001081083 Rosetta Predictions mouse pricing
XM_130012 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173081 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146563 predicted 2406
2 SASI_Hs02_00368076 predicted 768
3 SASI_Hs01_00146565 predicted 385
4 SASI_Hs02_00368077 predicted 1653
5 SASI_Hs02_00368078 predicted 576
6 SASI_Hs01_00146567 predicted 1696
7 SASI_Hs01_00146568 predicted 656
8 SASI_Hs01_00146569 predicted 1265
9 SASI_Hs01_00146570 predicted 1644
10 SASI_Hs02_00368079 predicted 332
11 SASI_Hs01_00146562 predicted 813
12 SASI_Hs01_00146564 predicted 775
13 SASI_Hs01_00146566 predicted 1765
14 SASI_Hs01_00146571 predicted 939
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225610 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00135945 predicted 775
2 SASI_Rn01_00135946 predicted 846
3 SASI_Rn01_00135947 predicted 201
4 SASI_Rn01_00135948 predicted 760
5 SASI_Rn01_00135949 predicted 854
6 SASI_Rn01_00135950 predicted 1023
7 SASI_Rn01_00135951 predicted 793
8 SASI_Rn01_00135952 predicted 978
9 SASI_Rn01_00135953 predicted 905
10 SASI_Rn01_00135954 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081083 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295011 predicted 1865
2 SASI_Mm02_00295012 predicted 971
3 SASI_Mm02_00295013 predicted 1966
4 SASI_Mm02_00295014 predicted 2079
5 SASI_Mm02_00295015 predicted 1951
6 SASI_Mm02_00295016 predicted 555
7 SASI_Mm02_00295017 predicted 286
8 SASI_Mm02_00295018 predicted 494
9 SASI_Mm02_00295019 predicted 378
10 SASI_Mm02_00295020 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130012 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202485 predicted 1872
2 SASI_Mm01_00202486 predicted 982
3 SASI_Mm01_00202487 predicted 2083
4 SASI_Mm01_00202488 predicted 1956
5 SASI_Mm01_00202489 predicted 551
6 SASI_Mm01_00202490 predicted 284
7 SASI_Mm01_00202491 predicted 496
8 SASI_Mm01_00202492 predicted 387
9 SASI_Mm01_00202493 predicted 2037
10 SASI_Mm01_00202494 predicted 522
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173081
ARMC3 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173081.3-2284s21c1
Sequence:CCGGTACTGCCAATAACCAATATTACTCGAGTAATATTGGTTATTGGCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173081.3-1947s21c1
Sequence:CCGGGTTGGTTATGGACGAAGTATTCTCGAGAATACTTCGTCCATAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173081.3-1800s21c1
Sequence:CCGGTATGATTATGGTCGGATAAATCTCGAGATTTATCCGACCATAATCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173081.3-124s21c1
Sequence:CCGGAGGATGTGTTTGACCCATTAACTCGAGTTAATGGGTCAAACACATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173081.1-1491s1c1
Sequence:CCGGGCCCGGACTGAGTTAAGAAATCTCGAGATTTCTTAACTCAGTCCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173081.1-834s1c1
Sequence:CCGGGCACTTGCAGTGATAGCCAATCTCGAGATTGGCTATCACTGCAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173081.1-1267s1c1
Sequence:CCGGCTGATGGTATTGATCCATTAACTCGAGTTAATGGATCAATACCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173081.1-1912s1c1
Sequence:CCGGCACCTTCATCTATGGAAGATACTCGAGTATCTTCCATAGATGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173081.1-2604s1c1
Sequence:CCGGGCTCCTGAGATGTACGTGATTCTCGAGAATCACGTACATCTCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173081.1-2673s1c1
Sequence:CCGGGCTGATCTTTACAGATTCATTCTCGAGAATGAATCTGTAAAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173081.1-758s1c1
Sequence:CCGGGCTAAGAGACAATCAAGGATTCTCGAGAATCCTTGATTGTCTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173081
ARMC3 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173081.3-2284s21c1
Sequence:CCGGTACTGCCAATAACCAATATTACTCGAGTAATATTGGTTATTGGCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173081.3-1947s21c1
Sequence:CCGGGTTGGTTATGGACGAAGTATTCTCGAGAATACTTCGTCCATAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173081.3-1800s21c1
Sequence:CCGGTATGATTATGGTCGGATAAATCTCGAGATTTATCCGACCATAATCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173081.3-124s21c1
Sequence:CCGGAGGATGTGTTTGACCCATTAACTCGAGTTAATGGGTCAAACACATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173081.1-1491s1c1
Sequence:CCGGGCCCGGACTGAGTTAAGAAATCTCGAGATTTCTTAACTCAGTCCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173081.1-834s1c1
Sequence:CCGGGCACTTGCAGTGATAGCCAATCTCGAGATTGGCTATCACTGCAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173081.1-1267s1c1
Sequence:CCGGCTGATGGTATTGATCCATTAACTCGAGTTAATGGATCAATACCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173081.1-1912s1c1
Sequence:CCGGCACCTTCATCTATGGAAGATACTCGAGTATCTTCCATAGATGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173081.1-2604s1c1
Sequence:CCGGGCTCCTGAGATGTACGTGATTCTCGAGAATCACGTACATCTCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173081.1-2673s1c1
Sequence:CCGGGCTGATCTTTACAGATTCATTCTCGAGAATGAATCTGTAAAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173081.1-758s1c1
Sequence:CCGGGCTAAGAGACAATCAAGGATTCTCGAGAATCCTTGATTGTCTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173081
ARMC3 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173081.3-2284s21c1
Sequence:CCGGTACTGCCAATAACCAATATTACTCGAGTAATATTGGTTATTGGCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173081.3-1947s21c1
Sequence:CCGGGTTGGTTATGGACGAAGTATTCTCGAGAATACTTCGTCCATAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173081.3-1800s21c1
Sequence:CCGGTATGATTATGGTCGGATAAATCTCGAGATTTATCCGACCATAATCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173081.3-124s21c1
Sequence:CCGGAGGATGTGTTTGACCCATTAACTCGAGTTAATGGGTCAAACACATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173081.1-1491s1c1
Sequence:CCGGGCCCGGACTGAGTTAAGAAATCTCGAGATTTCTTAACTCAGTCCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173081.1-834s1c1
Sequence:CCGGGCACTTGCAGTGATAGCCAATCTCGAGATTGGCTATCACTGCAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173081.1-1267s1c1
Sequence:CCGGCTGATGGTATTGATCCATTAACTCGAGTTAATGGATCAATACCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173081.1-1912s1c1
Sequence:CCGGCACCTTCATCTATGGAAGATACTCGAGTATCTTCCATAGATGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173081.1-2604s1c1
Sequence:CCGGGCTCCTGAGATGTACGTGATTCTCGAGAATCACGTACATCTCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173081.1-2673s1c1
Sequence:CCGGGCTGATCTTTACAGATTCATTCTCGAGAATGAATCTGTAAAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173081.1-758s1c1
Sequence:CCGGGCTAAGAGACAATCAAGGATTCTCGAGAATCCTTGATTGTCTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081083
ARMC3 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081083.1-813s21c1
Sequence:CCGGATGCAATCCCTCCGATATTAGCTCGAGCTAATATCGGAGGGATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081083.1-1436s21c1
Sequence:CCGGGCCATTGACCCGCTGATTAACCTCGAGGTTAATCAGCGGGTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081083.1-1958s21c1
Sequence:CCGGTATGATTACGGTCGGATAAATCTCGAGATTTATCCGACCGTAATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081083.1-2162s21c1
Sequence:CCGGGAGAAGGCCAATGCTATATTTCTCGAGAAATATAGCATTGGCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081083.1-373s21c1
Sequence:CCGGAGCCTGCGAAGCCATCTATAACTCGAGTTATAGATGGCTTCGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081083
ARMC3 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081083.1-813s21c1
Sequence:CCGGATGCAATCCCTCCGATATTAGCTCGAGCTAATATCGGAGGGATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081083.1-1436s21c1
Sequence:CCGGGCCATTGACCCGCTGATTAACCTCGAGGTTAATCAGCGGGTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081083.1-1958s21c1
Sequence:CCGGTATGATTACGGTCGGATAAATCTCGAGATTTATCCGACCGTAATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081083.1-2162s21c1
Sequence:CCGGGAGAAGGCCAATGCTATATTTCTCGAGAAATATAGCATTGGCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081083.1-373s21c1
Sequence:CCGGAGCCTGCGAAGCCATCTATAACTCGAGTTATAGATGGCTTCGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081083
ARMC3 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081083.1-813s21c1
Sequence:CCGGATGCAATCCCTCCGATATTAGCTCGAGCTAATATCGGAGGGATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081083.1-1436s21c1
Sequence:CCGGGCCATTGACCCGCTGATTAACCTCGAGGTTAATCAGCGGGTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081083.1-1958s21c1
Sequence:CCGGTATGATTACGGTCGGATAAATCTCGAGATTTATCCGACCGTAATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081083.1-2162s21c1
Sequence:CCGGGAGAAGGCCAATGCTATATTTCTCGAGAAATATAGCATTGGCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081083.1-373s21c1
Sequence:CCGGAGCCTGCGAAGCCATCTATAACTCGAGTTATAGATGGCTTCGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks