EMAIL THIS PAGE TO A FRIEND

ARMC4

armadillo repeat containing 4

79 Gene Product Result for
UniProtKB ID: Q5T2S8, Q9H0C0
Gene ID:
Mouse(74934) armadillo repeat containing 4
Rat(307036) armadillo repeat containing 4
naked mole-rat(101699290) armadillo repeat containing 4
domestic guinea pig(100721148) armadillo repeat containing 4
sheep(101118121) armadillo repeat containing 4
Domestic Rabbit(100356534) armadillo repeat containing 4
Zebrafish(799229) armadillo repeat containing 4
cow(526515) armadillo repeat containing 4
Horse(100055205) armadillo repeat containing 4
domestic cat(101088848) armadillo repeat containing 4
dog(477959) armadillo repeat containing 4
chicken(420482) armadillo repeat containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018076 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018076 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018076 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081393 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081393 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081393 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018076 Rosetta Predictions human pricing
XM_001064097 Rosetta Predictions rat pricing
XM_225474 Rosetta Predictions rat pricing
NM_001081393 Rosetta Predictions mouse pricing
XM_975536 Rosetta Predictions mouse pricing
XM_975588 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018076 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016886 predicted 1944
2 SASI_Hs01_00016887 predicted 2585
3 SASI_Hs02_00351227 predicted 2346
4 SASI_Hs01_00016888 predicted 2596
5 SASI_Hs01_00016889 predicted 1698
6 SASI_Hs01_00016890 predicted 1517
7 SASI_Hs01_00016891 predicted 2917
8 SASI_Hs01_00016892 predicted 3105
9 SASI_Hs01_00016893 predicted 2246
10 SASI_Hs01_00016894 predicted 2561
11 SASI_Hs01_00016895 predicted 2471
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064097 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309339 predicted 372
2 SASI_Rn02_00309340 predicted 798
3 SASI_Rn02_00309341 predicted 2818
4 SASI_Rn02_00309342 predicted 1345
5 SASI_Rn02_00309343 predicted 1064
6 SASI_Rn02_00309344 predicted 2272
7 SASI_Rn02_00309345 predicted 2132
8 SASI_Rn02_00309346 predicted 2348
9 SASI_Rn02_00309347 predicted 2603
10 SASI_Rn02_00309348 predicted 2025
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225474 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382855 predicted 373
2 SASI_Rn02_00382856 predicted 798
3 SASI_Rn02_00382857 predicted 2828
4 SASI_Rn02_00382858 predicted 1338
5 SASI_Rn02_00382859 predicted 1057
6 SASI_Rn02_00382860 predicted 1121
7 SASI_Rn02_00382861 predicted 3028
8 SASI_Rn02_00382862 predicted 2911
9 SASI_Rn02_00382863 predicted 601
10 SASI_Rn02_00382864 predicted 2106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081393 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297961 predicted 1125
2 SASI_Mm02_00297962 predicted 236
3 SASI_Mm02_00297963 predicted 799
4 SASI_Mm02_00297964 predicted 1190
5 SASI_Mm02_00297965 predicted 3123
6 SASI_Mm02_00297966 predicted 225
7 SASI_Mm02_00297967 predicted 2782
8 SASI_Mm02_00297968 predicted 3140
9 SASI_Mm02_00297969 predicted 337
10 SASI_Mm02_00297970 predicted 2594
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975536 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221061 predicted 2287
2 SASI_Mm01_00221062 predicted 2129
3 SASI_Mm01_00221063 predicted 2767
4 SASI_Mm01_00221064 predicted 3122
5 SASI_Mm01_00221065 predicted 2563
6 SASI_Mm01_00221066 predicted 3049
7 SASI_Mm01_00221067 predicted 2781
8 SASI_Mm01_00221068 predicted 3146
9 SASI_Mm01_00221069 predicted 2774
10 SASI_Mm01_00221070 predicted 2599
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975588 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224573 predicted 2897
2 SASI_Mm01_00224574 predicted 2906
3 SASI_Mm01_00224575 predicted 2867
4 SASI_Mm01_00224576 predicted 2864
5 SASI_Mm01_00224577 predicted 3129
6 SASI_Mm01_00224578 predicted 3151
7 SASI_Mm01_00224579 predicted 3083
8 SASI_Mm01_00224580 predicted 2843
9 SASI_Mm01_00224581 predicted 2956
10 SASI_Mm01_00224582 predicted 3030
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018076
VALIDATED
ARMC4 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing 4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018076.2-1449s1c1
Sequence:CCGGGCAAATTCAGAAGCTGGTGAACTCGAGTTCACCAGCTTCTGAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_018076.2-2789s1c1
Sequence:CCGGCAAGTGTATGTGCTGCCATTACTCGAGTAATGGCAGCACATACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018076.2-2268s1c1
Sequence:CCGGCACTGACAATAAAGAGCGGTTCTCGAGAACCGCTCTTTATTGTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018076.2-1770s1c1
Sequence:CCGGCGCGAATGTTGCCAAGTTTAACTCGAGTTAAACTTGGCAACATTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018076.2-3315s1c1
Sequence:CCGGGTTGTTAGCAAACCCTTTCAACTCGAGTTGAAAGGGTTTGCTAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_018076.2-2350s1c1
Sequence:CCGGCGGGAATACAAAGCCATTGAACTCGAGTTCAATGGCTTTGTATTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_018076.2-287s1c1
Sequence:CCGGCCTCAGCATTTGAATCAGGTTCTCGAGAACCTGATTCAAATGCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018076.2-2502s21c1
Sequence:GTACCGGGAACCTCCTTGTTGGAATAAACTCGAGTTTATTCCAACAAGGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018076.2-3286s21c1
Sequence:CCGGCATGGCCAGAAAGCCTAAATTCTCGAGAATTTAGGCTTTCTGGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018076.2-2246s21c1
Sequence:CCGGCCTTGGCCAGTCTACTCAATACTCGAGTATTGAGTAGACTGGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018076.2-1948s21c1
Sequence:CCGGAGTAAGAGTCATACGAATAAACTCGAGTTTATTCGTATGACTCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018076.2-883s21c1
Sequence:CCGGTGCAGTGCAGGAGGAGTATTTCTCGAGAAATACTCCTCCTGCACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018076
VALIDATED
ARMC4 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing 4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018076.2-1449s1c1
Sequence:CCGGGCAAATTCAGAAGCTGGTGAACTCGAGTTCACCAGCTTCTGAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_018076.2-2789s1c1
Sequence:CCGGCAAGTGTATGTGCTGCCATTACTCGAGTAATGGCAGCACATACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018076.2-2268s1c1
Sequence:CCGGCACTGACAATAAAGAGCGGTTCTCGAGAACCGCTCTTTATTGTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018076.2-1770s1c1
Sequence:CCGGCGCGAATGTTGCCAAGTTTAACTCGAGTTAAACTTGGCAACATTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018076.2-3315s1c1
Sequence:CCGGGTTGTTAGCAAACCCTTTCAACTCGAGTTGAAAGGGTTTGCTAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_018076.2-2350s1c1
Sequence:CCGGCGGGAATACAAAGCCATTGAACTCGAGTTCAATGGCTTTGTATTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_018076.2-287s1c1
Sequence:CCGGCCTCAGCATTTGAATCAGGTTCTCGAGAACCTGATTCAAATGCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018076.2-2502s21c1
Sequence:GTACCGGGAACCTCCTTGTTGGAATAAACTCGAGTTTATTCCAACAAGGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018076.2-3286s21c1
Sequence:CCGGCATGGCCAGAAAGCCTAAATTCTCGAGAATTTAGGCTTTCTGGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018076.2-2246s21c1
Sequence:CCGGCCTTGGCCAGTCTACTCAATACTCGAGTATTGAGTAGACTGGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018076.2-1948s21c1
Sequence:CCGGAGTAAGAGTCATACGAATAAACTCGAGTTTATTCGTATGACTCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018076.2-883s21c1
Sequence:CCGGTGCAGTGCAGGAGGAGTATTTCTCGAGAAATACTCCTCCTGCACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018076
VALIDATED
ARMC4 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing 4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018076.2-1449s1c1
Sequence:CCGGGCAAATTCAGAAGCTGGTGAACTCGAGTTCACCAGCTTCTGAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_018076.2-2789s1c1
Sequence:CCGGCAAGTGTATGTGCTGCCATTACTCGAGTAATGGCAGCACATACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018076.2-2268s1c1
Sequence:CCGGCACTGACAATAAAGAGCGGTTCTCGAGAACCGCTCTTTATTGTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018076.2-1770s1c1
Sequence:CCGGCGCGAATGTTGCCAAGTTTAACTCGAGTTAAACTTGGCAACATTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018076.2-3315s1c1
Sequence:CCGGGTTGTTAGCAAACCCTTTCAACTCGAGTTGAAAGGGTTTGCTAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_018076.2-2350s1c1
Sequence:CCGGCGGGAATACAAAGCCATTGAACTCGAGTTCAATGGCTTTGTATTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_018076.2-287s1c1
Sequence:CCGGCCTCAGCATTTGAATCAGGTTCTCGAGAACCTGATTCAAATGCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018076.2-2502s21c1
Sequence:GTACCGGGAACCTCCTTGTTGGAATAAACTCGAGTTTATTCCAACAAGGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018076.2-3286s21c1
Sequence:CCGGCATGGCCAGAAAGCCTAAATTCTCGAGAATTTAGGCTTTCTGGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018076.2-2246s21c1
Sequence:CCGGCCTTGGCCAGTCTACTCAATACTCGAGTATTGAGTAGACTGGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018076.2-1948s21c1
Sequence:CCGGAGTAAGAGTCATACGAATAAACTCGAGTTTATTCGTATGACTCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018076.2-883s21c1
Sequence:CCGGTGCAGTGCAGGAGGAGTATTTCTCGAGAAATACTCCTCCTGCACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081393
ARMC4 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081393.1-3277s21c1
Sequence:CCGGACCAAATGTTCTAAGGATATACTCGAGTATATCCTTAGAACATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081393.1-2629s21c1
Sequence:CCGGCTTAGATGGAGTTCGCTTATTCTCGAGAATAAGCGAACTCCATCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081393.1-1727s21c1
Sequence:CCGGGGCCTACCAATTATGGTTAATCTCGAGATTAACCATAATTGGTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081393.1-1572s21c1
Sequence:CCGGAGACCTGCCAGCTAGCAATTACTCGAGTAATTGCTAGCTGGCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081393.1-1693s21c1
Sequence:CCGGTCCTCAAATCAGACGTAATATCTCGAGATATTACGTCTGATTTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081393
ARMC4 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081393.1-3277s21c1
Sequence:CCGGACCAAATGTTCTAAGGATATACTCGAGTATATCCTTAGAACATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081393.1-2629s21c1
Sequence:CCGGCTTAGATGGAGTTCGCTTATTCTCGAGAATAAGCGAACTCCATCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081393.1-1727s21c1
Sequence:CCGGGGCCTACCAATTATGGTTAATCTCGAGATTAACCATAATTGGTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081393.1-1572s21c1
Sequence:CCGGAGACCTGCCAGCTAGCAATTACTCGAGTAATTGCTAGCTGGCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081393.1-1693s21c1
Sequence:CCGGTCCTCAAATCAGACGTAATATCTCGAGATATTACGTCTGATTTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081393
ARMC4 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081393.1-3277s21c1
Sequence:CCGGACCAAATGTTCTAAGGATATACTCGAGTATATCCTTAGAACATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081393.1-2629s21c1
Sequence:CCGGCTTAGATGGAGTTCGCTTATTCTCGAGAATAAGCGAACTCCATCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081393.1-1727s21c1
Sequence:CCGGGGCCTACCAATTATGGTTAATCTCGAGATTAACCATAATTGGTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081393.1-1572s21c1
Sequence:CCGGAGACCTGCCAGCTAGCAATTACTCGAGTAATTGCTAGCTGGCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081393.1-1693s21c1
Sequence:CCGGTCCTCAAATCAGACGTAATATCTCGAGATATTACGTCTGATTTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks