EMAIL THIS PAGE TO A FRIEND

ARMC5

armadillo repeat containing 5

167 Gene Product Result for
UniProtKB ID: Q96C12, Q86WM9, Q9H7P8, Q9H925
Gene ID:
Mouse(233912) armadillo repeat containing 5
Rat(361653) armadillo repeat containing 5
Zebrafish(569910) armadillo repeat containing 5
domestic cat(101081595) armadillo repeat containing 5
cow(515835) armadillo repeat containing 5
dog(489931) armadillo repeat containing 5
sheep(101106993) armadillo repeat containing 5
domestic guinea pig(100735975) armadillo repeat containing 5
naked mole-rat(101720472) armadillo repeat containing 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024742 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024742 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024742 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146205 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146205 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146205 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134951 MISSION® esiRNA esiRNA human ARMC5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105247 Rosetta Predictions human pricing
NM_024742 Rosetta Predictions human pricing
NM_001009455 Rosetta Predictions rat pricing
NM_146205 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105247 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324054 predicted 1619
2 SASI_Hs02_00324055 predicted 1424
3 SASI_Hs02_00324056 predicted 3355
4 SASI_Hs02_00324057 predicted 1904
5 SASI_Hs02_00324058 predicted 1682
6 SASI_Hs02_00324059 predicted 1132
7 SASI_Hs02_00324060 predicted 1457
8 SASI_Hs02_00324061 predicted 1407
9 SASI_Hs02_00324062 predicted 3126
10 SASI_Hs02_00324063 predicted 2925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024742 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146236 predicted 1623
2 SASI_Hs01_00146239 predicted 1430
3 SASI_Hs01_00146240 predicted 1903
4 SASI_Hs02_00357222 predicted 1428
5 SASI_Hs01_00146241 predicted 1686
6 SASI_Hs01_00146242 predicted 1132
7 SASI_Hs02_00357223 predicted 1830
8 SASI_Hs01_00146243 predicted 1458
9 SASI_Hs01_00146244 predicted 1405
10 SASI_Hs02_00357224 predicted 1903
11 SASI_Hs01_00146237 predicted 2516
12 SASI_Hs01_00146238 predicted 2233
13 SASI_Hs01_00146245 predicted 2578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009455 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090877 predicted 1163
2 SASI_Rn01_00090878 predicted 1566
3 SASI_Rn01_00090879 predicted 2977
4 SASI_Rn02_00199546 predicted 663
5 SASI_Rn01_00090881 predicted 1919
6 SASI_Rn01_00090883 predicted 295
7 SASI_Rn01_00090884 predicted 1411
8 SASI_Rn01_00090885 predicted 1576
9 SASI_Rn01_00090886 predicted 2298
10 SASI_Rn02_00199547 predicted 1263
11 SASI_Rn01_00090880 predicted 359
12 SASI_Rn01_00090882 predicted 2682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146205 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145325 predicted 1728
2 SASI_Mm01_00145326 predicted 3529
3 SASI_Mm01_00145327 predicted 2008
4 SASI_Mm01_00145328 predicted 3548
5 SASI_Mm01_00145329 predicted 3536
6 SASI_Mm01_00145330 predicted 1225
7 SASI_Mm01_00145331 predicted 2477
8 SASI_Mm01_00145332 predicted 849
9 SASI_Mm01_00145333 predicted 2143
10 SASI_Mm01_00145334 predicted 2887
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024742
ARMC5 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024742.2-1417s21c1
Sequence:CCGGAGTACGCGAGGGAACCATTCTCTCGAGAGAATGGTTCCCTCGCGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024742.2-1592s21c1
Sequence:CCGGCTATGTCGTGAGGCCATCAACCTCGAGGTTGATGGCCTCACGACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157871    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024742.1-3991s1c1
Sequence:CCGGCCTGTCCTGCATCATTTGCATCTCGAGATGCAAATGATGCAGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024742.1-1018s1c1
Sequence:CCGGGTGCATGAAGACAGACAGCATCTCGAGATGCTGTCTGTCTTCATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024742.1-1024s1c1
Sequence:CCGGGAAGACAGACAGCATCCAGAACTCGAGTTCTGGATGCTGTCTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024742.1-997s1c1
Sequence:CCGGCCCTTTGGTGACCATTCTTCACTCGAGTGAAGAATGGTCACCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024742.1-4424s1c1
Sequence:CCGGCAAGGATGAATTGGCTGTGAACTCGAGTTCACAGCCAATTCATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024742
ARMC5 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024742.2-1417s21c1
Sequence:CCGGAGTACGCGAGGGAACCATTCTCTCGAGAGAATGGTTCCCTCGCGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024742.2-1592s21c1
Sequence:CCGGCTATGTCGTGAGGCCATCAACCTCGAGGTTGATGGCCTCACGACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157871    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024742.1-3991s1c1
Sequence:CCGGCCTGTCCTGCATCATTTGCATCTCGAGATGCAAATGATGCAGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024742.1-1018s1c1
Sequence:CCGGGTGCATGAAGACAGACAGCATCTCGAGATGCTGTCTGTCTTCATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024742.1-1024s1c1
Sequence:CCGGGAAGACAGACAGCATCCAGAACTCGAGTTCTGGATGCTGTCTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024742.1-997s1c1
Sequence:CCGGCCCTTTGGTGACCATTCTTCACTCGAGTGAAGAATGGTCACCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024742.1-4424s1c1
Sequence:CCGGCAAGGATGAATTGGCTGTGAACTCGAGTTCACAGCCAATTCATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024742
ARMC5 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024742.2-1417s21c1
Sequence:CCGGAGTACGCGAGGGAACCATTCTCTCGAGAGAATGGTTCCCTCGCGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024742.2-1592s21c1
Sequence:CCGGCTATGTCGTGAGGCCATCAACCTCGAGGTTGATGGCCTCACGACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157871    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024742.1-3991s1c1
Sequence:CCGGCCTGTCCTGCATCATTTGCATCTCGAGATGCAAATGATGCAGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024742.1-1018s1c1
Sequence:CCGGGTGCATGAAGACAGACAGCATCTCGAGATGCTGTCTGTCTTCATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024742.1-1024s1c1
Sequence:CCGGGAAGACAGACAGCATCCAGAACTCGAGTTCTGGATGCTGTCTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024742.1-997s1c1
Sequence:CCGGCCCTTTGGTGACCATTCTTCACTCGAGTGAAGAATGGTCACCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024742.1-4424s1c1
Sequence:CCGGCAAGGATGAATTGGCTGTGAACTCGAGTTCACAGCCAATTCATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146205
ARMC5 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing 5
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146205.2-3556s21c1
Sequence:CCGGTATGCCCTAGGCTAAACTATTCTCGAGAATAGTTTAGCCTAGGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146205.2-1629s21c1
Sequence:CCGGTCTCACCCTAAACGGGCAATACTCGAGTATTGCCCGTTTAGGGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146205.2-3161s21c1
Sequence:CCGGGTGGCCTGTCTTACATCATTTCTCGAGAAATGATGTAAGACAGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146205.2-1940s21c1
Sequence:CCGGTGTAGGCTTCCTTTATGATACCTCGAGGTATCATAAAGGAAGCCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146205.2-1804s21c1
Sequence:CCGGTGCGAGCTGTGTGCCTCTTATCTCGAGATAAGAGGCACACAGCTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178622    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146205.2-3695s1c1
Sequence:CCGGCCAGGATGAAGATCTAACGATCTCGAGATCGTTAGATCTTCATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146205
ARMC5 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing 5
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146205.2-3556s21c1
Sequence:CCGGTATGCCCTAGGCTAAACTATTCTCGAGAATAGTTTAGCCTAGGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146205.2-1629s21c1
Sequence:CCGGTCTCACCCTAAACGGGCAATACTCGAGTATTGCCCGTTTAGGGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146205.2-3161s21c1
Sequence:CCGGGTGGCCTGTCTTACATCATTTCTCGAGAAATGATGTAAGACAGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146205.2-1940s21c1
Sequence:CCGGTGTAGGCTTCCTTTATGATACCTCGAGGTATCATAAAGGAAGCCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146205.2-1804s21c1
Sequence:CCGGTGCGAGCTGTGTGCCTCTTATCTCGAGATAAGAGGCACACAGCTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178622    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146205.2-3695s1c1
Sequence:CCGGCCAGGATGAAGATCTAACGATCTCGAGATCGTTAGATCTTCATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146205
ARMC5 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing 5
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146205.2-3556s21c1
Sequence:CCGGTATGCCCTAGGCTAAACTATTCTCGAGAATAGTTTAGCCTAGGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146205.2-1629s21c1
Sequence:CCGGTCTCACCCTAAACGGGCAATACTCGAGTATTGCCCGTTTAGGGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146205.2-3161s21c1
Sequence:CCGGGTGGCCTGTCTTACATCATTTCTCGAGAAATGATGTAAGACAGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146205.2-1940s21c1
Sequence:CCGGTGTAGGCTTCCTTTATGATACCTCGAGGTATCATAAAGGAAGCCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146205.2-1804s21c1
Sequence:CCGGTGCGAGCTGTGTGCCTCTTATCTCGAGATAAGAGGCACACAGCTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178622    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146205.2-3695s1c1
Sequence:CCGGCCAGGATGAAGATCTAACGATCTCGAGATCGTTAGATCTTCATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks