EMAIL THIS PAGE TO A FRIEND

ARMC6

armadillo repeat containing 6

54 Gene Product Result for
Synonyms: R30923_1
UniProtKB ID: Q6NXE6, B4DI98, O94999, Q9BTH5
Gene ID:
Human(93436) Summary: The function of this gene's protein product has not been determined. A related protein in mouse suggests that this protein has a conserved function. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Mouse(76813) armadillo repeat containing 6
Rat(306352) armadillo repeat containing 6
naked mole-rat(101709980) armadillo repeat containing 6
domestic guinea pig(100715775) armadillo repeat containing 6
sheep(101106680) armadillo repeat containing 6
chicken(420112) armadillo repeat containing 6
cow(514111) armadillo repeat containing 6
Horse(100071113) armadillo repeat containing 6
domestic cat(101090676) armadillo repeat containing 6
dog(484811) armadillo repeat containing 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1103023 Anti-ARMC6 (31-43) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1103024 Anti-ARMC6 (461-475) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1300692 Anti-ARMC6 (center) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1300691 Anti-ARMC6 (N-term) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1400770 Anti-ARMC6 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
HPA041420 Anti-ARMC6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA041681 Anti-ARMC6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4503627 Anti-ARMC6, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, western blot pricing
SAB1403427 Monoclonal Anti-ARMC6 antibody produced in mouse clone 2H8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033415 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033415 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033415 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133972 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133972 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133972 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000061 MISSION® esiRNA esiRNA targeting human ARMC6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033415 Rosetta Predictions human pricing
NM_001107306 Rosetta Predictions rat pricing
NM_133972 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043761 predicted 459
2 SASI_Hs01_00043762 predicted 811
3 SASI_Hs01_00043763 predicted 1029
4 SASI_Hs01_00043764 predicted 1056
5 SASI_Hs01_00043765 predicted 970
6 SASI_Hs02_00361310 predicted 1893
7 SASI_Hs01_00043767 predicted 1099
8 SASI_Hs02_00361311 predicted 688
9 SASI_Hs01_00043769 predicted 523
10 SASI_Hs02_00361312 predicted 320
11 SASI_Hs01_00043760 predicted 1305
12 SASI_Hs01_00043766 predicted 1257
13 SASI_Hs01_00043768 predicted 1447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107306 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227535 predicted 960
2 SASI_Rn02_00227536 predicted 1088
3 SASI_Rn02_00227537 predicted 852
4 SASI_Rn02_00227538 predicted 413
5 SASI_Rn02_00227539 predicted 1036
6 SASI_Rn02_00227540 predicted 764
7 SASI_Rn02_00227541 predicted 412
8 SASI_Rn02_00227542 predicted 867
9 SASI_Rn02_00227543 predicted 1026
10 SASI_Rn02_00227544 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133972 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339087 predicted 1419
2 SASI_Mm02_00339088 predicted 1035
3 SASI_Mm02_00339089 predicted 1514
4 SASI_Mm02_00339090 predicted 987
5 SASI_Mm02_00339091 predicted 1473
6 SASI_Mm02_00339092 predicted 1723
7 SASI_Mm02_00339093 predicted 1946
8 SASI_Mm02_00339094 predicted 1334
9 SASI_Mm02_00339095 predicted 1915
10 SASI_Mm02_00339096 predicted 1710
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033415
ARMC6 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing 6
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033415.2-453s1c1
Sequence:CCGGCATTGTAAAGACGGCACCTAACTCGAGTTAGGTGCCGTCTTTACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033415.2-654s1c1
Sequence:CCGGCATCATCTTCACTGCCTGGAACTCGAGTTCCAGGCAGTGAAGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033415.2-1314s1c1
Sequence:CCGGCGACGTGAAAGATGCTATTGTCTCGAGACAATAGCATCTTTCACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129211    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033415.2-2164s1c1
Sequence:CCGGCTCTGCTCCTTGTCTTTCTTACTCGAGTAAGAAAGACAAGGAGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033415.2-1842s1c1
Sequence:CCGGCCCTTCACAATGAGAAGTGTTCTCGAGAACACTTCTCATTGTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033415.2-1032s1c1
Sequence:CCGGCCATGCCAAGATGATTGTGCACTCGAGTGCACAATCATCTTGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033415
ARMC6 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing 6
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033415.2-453s1c1
Sequence:CCGGCATTGTAAAGACGGCACCTAACTCGAGTTAGGTGCCGTCTTTACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033415.2-654s1c1
Sequence:CCGGCATCATCTTCACTGCCTGGAACTCGAGTTCCAGGCAGTGAAGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033415.2-1314s1c1
Sequence:CCGGCGACGTGAAAGATGCTATTGTCTCGAGACAATAGCATCTTTCACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129211    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033415.2-2164s1c1
Sequence:CCGGCTCTGCTCCTTGTCTTTCTTACTCGAGTAAGAAAGACAAGGAGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033415.2-1842s1c1
Sequence:CCGGCCCTTCACAATGAGAAGTGTTCTCGAGAACACTTCTCATTGTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033415.2-1032s1c1
Sequence:CCGGCCATGCCAAGATGATTGTGCACTCGAGTGCACAATCATCTTGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033415
ARMC6 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing 6
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033415.2-453s1c1
Sequence:CCGGCATTGTAAAGACGGCACCTAACTCGAGTTAGGTGCCGTCTTTACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033415.2-654s1c1
Sequence:CCGGCATCATCTTCACTGCCTGGAACTCGAGTTCCAGGCAGTGAAGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033415.2-1314s1c1
Sequence:CCGGCGACGTGAAAGATGCTATTGTCTCGAGACAATAGCATCTTTCACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129211    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033415.2-2164s1c1
Sequence:CCGGCTCTGCTCCTTGTCTTTCTTACTCGAGTAAGAAAGACAAGGAGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033415.2-1842s1c1
Sequence:CCGGCCCTTCACAATGAGAAGTGTTCTCGAGAACACTTCTCATTGTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033415.2-1032s1c1
Sequence:CCGGCCATGCCAAGATGATTGTGCACTCGAGTGCACAATCATCTTGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133972
ARMC6 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133972.2-512s21c1
Sequence:CCGGAGTGTCCTTCAGGCCCTTAACCTCGAGGTTAAGGGCCTGAAGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133972.2-879s21c1
Sequence:CCGGATCGGCAGGACTTGGTGAAAGCTCGAGCTTTCACCAAGTCCTGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133972.2-1425s21c1
Sequence:CCGGCAGACAACAGCCGGGTCATTACTCGAGTAATGACCCGGCTGTTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133972.2-2008s21c1
Sequence:CCGGACCACTCCAAGCAGTTGATAACTCGAGTTATCAACTGCTTGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133972.2-989s21c1
Sequence:CCGGATGACCTTTGATGATGATATCCTCGAGGATATCATCATCAAAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133972
ARMC6 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133972.2-512s21c1
Sequence:CCGGAGTGTCCTTCAGGCCCTTAACCTCGAGGTTAAGGGCCTGAAGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133972.2-879s21c1
Sequence:CCGGATCGGCAGGACTTGGTGAAAGCTCGAGCTTTCACCAAGTCCTGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133972.2-1425s21c1
Sequence:CCGGCAGACAACAGCCGGGTCATTACTCGAGTAATGACCCGGCTGTTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133972.2-2008s21c1
Sequence:CCGGACCACTCCAAGCAGTTGATAACTCGAGTTATCAACTGCTTGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133972.2-989s21c1
Sequence:CCGGATGACCTTTGATGATGATATCCTCGAGGATATCATCATCAAAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133972
ARMC6 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133972.2-512s21c1
Sequence:CCGGAGTGTCCTTCAGGCCCTTAACCTCGAGGTTAAGGGCCTGAAGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133972.2-879s21c1
Sequence:CCGGATCGGCAGGACTTGGTGAAAGCTCGAGCTTTCACCAAGTCCTGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133972.2-1425s21c1
Sequence:CCGGCAGACAACAGCCGGGTCATTACTCGAGTAATGACCCGGCTGTTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133972.2-2008s21c1
Sequence:CCGGACCACTCCAAGCAGTTGATAACTCGAGTTATCAACTGCTTGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133972.2-989s21c1
Sequence:CCGGATGACCTTTGATGATGATATCCTCGAGGATATCATCATCAAAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks