EMAIL THIS PAGE TO A FRIEND

ARMC7

armadillo repeat containing 7

49 Gene Product Result for
UniProtKB ID: Q9H6L4
Gene ID:
Mouse(276905) armadillo repeat containing 7
Rat(287827) armadillo repeat containing 7
Zebrafish(767659) armadillo repeat containing 7
cow(613424) armadillo repeat containing 7
domestic cat(101097854) armadillo repeat containing 7
dog(608659) armadillo repeat containing 7
chicken(422118) armadillo repeat containing 7
sheep(101122203) armadillo repeat containing 7
domestic guinea pig(100714369) armadillo repeat containing 7
naked mole-rat(101710027) armadillo repeat containing 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177778 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177778 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177778 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024585 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024585 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024585 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024585 Rosetta Predictions human pricing
NM_001127522 Rosetta Predictions rat pricing
NM_177778 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024585 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026841 predicted 1152
2 SASI_Hs01_00026842 predicted 1181
3 SASI_Hs01_00026843 predicted 854
4 SASI_Hs01_00026844 predicted 1272
5 SASI_Hs01_00026845 predicted 1265
6 SASI_Hs02_00356919 predicted 1268
7 SASI_Hs01_00026847 predicted 1077
8 SASI_Hs02_00356920 predicted 1323
9 SASI_Hs01_00026848 predicted 1106
10 SASI_Hs01_00026849 predicted 1023
11 SASI_Hs01_00026846 predicted 1334
12 SASI_Hs01_00026850 predicted 1230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127522 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253973 predicted 876
2 SASI_Rn02_00253974 predicted 1050
3 SASI_Rn02_00253975 predicted 1045
4 SASI_Rn02_00253976 predicted 756
5 SASI_Rn02_00253977 predicted 1298
6 SASI_Rn02_00253978 predicted 1243
7 SASI_Rn02_00253979 predicted 604
8 SASI_Rn02_00253980 predicted 959
9 SASI_Rn02_00253981 predicted 1129
10 SASI_Rn02_00253982 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177778 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118946 predicted 1257
2 SASI_Mm02_00348177 predicted 960
3 SASI_Mm01_00118947 predicted 433
4 SASI_Mm01_00118948 predicted 1119
5 SASI_Mm01_00118949 predicted 978
6 SASI_Mm01_00118950 predicted 1236
7 SASI_Mm01_00118951 predicted 1342
8 SASI_Mm01_00118953 predicted 1161
9 SASI_Mm01_00118954 predicted 1164
10 SASI_Mm02_00348178 predicted 728
11 SASI_Mm01_00118945 predicted 1054
12 SASI_Mm01_00118952 predicted 515
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177778
VALIDATED
ARMC7 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing 7
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177778.4-1826s21c1
Sequence:CCGGCGGCCCAACCTCTAATCTAATCTCGAGATTAGATTAGAGGTTGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177778.4-471s21c1
Sequence:CCGGGAAACCCTAATCAAGTTTGCTCTCGAGAGCAAACTTGATTAGGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177778.4-739s21c1
Sequence:CCGGCCCAGATATTCCTAGAGGACTCTCGAGAGTCCTCTAGGAATATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177778.4-423s21c1
Sequence:CCGGCAACTACAAGTCCTGGACTTACTCGAGTAAGTCCAGGACTTGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177778.3-1825s1c1
Sequence:CCGGCGGCCCAACCTCTAATCTAATCTCGAGATTAGATTAGAGGTTGGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177778.3-423s1c1
Sequence:CCGGCAACTACAAGTCCTGGACTTACTCGAGTAAGTCCAGGACTTGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177778.3-471s1c1
Sequence:CCGGGAAACCCTAATCAAGTTTGCTCTCGAGAGCAAACTTGATTAGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177778.3-739s1c1
Sequence:CCGGCCCAGATATTCCTAGAGGACTCTCGAGAGTCCTCTAGGAATATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177778.3-411s1c1
Sequence:CCGGCAGTACCTACGGCAACTACAACTCGAGTTGTAGTTGCCGTAGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177778.3-446s1c1
Sequence:CCGGCCTTGATTCTCTGTCGGAAGACTCGAGTCTTCCGACAGAGAATCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177778.3-881s1c1
Sequence:CCGGCCACAGGTATAGGAAGCAGAACTCGAGTTCTGCTTCCTATACCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177778
VALIDATED
ARMC7 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing 7
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177778.4-1826s21c1
Sequence:CCGGCGGCCCAACCTCTAATCTAATCTCGAGATTAGATTAGAGGTTGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177778.4-471s21c1
Sequence:CCGGGAAACCCTAATCAAGTTTGCTCTCGAGAGCAAACTTGATTAGGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177778.4-739s21c1
Sequence:CCGGCCCAGATATTCCTAGAGGACTCTCGAGAGTCCTCTAGGAATATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177778.4-423s21c1
Sequence:CCGGCAACTACAAGTCCTGGACTTACTCGAGTAAGTCCAGGACTTGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177778.3-1825s1c1
Sequence:CCGGCGGCCCAACCTCTAATCTAATCTCGAGATTAGATTAGAGGTTGGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177778.3-423s1c1
Sequence:CCGGCAACTACAAGTCCTGGACTTACTCGAGTAAGTCCAGGACTTGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177778.3-471s1c1
Sequence:CCGGGAAACCCTAATCAAGTTTGCTCTCGAGAGCAAACTTGATTAGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177778.3-739s1c1
Sequence:CCGGCCCAGATATTCCTAGAGGACTCTCGAGAGTCCTCTAGGAATATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177778.3-411s1c1
Sequence:CCGGCAGTACCTACGGCAACTACAACTCGAGTTGTAGTTGCCGTAGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177778.3-446s1c1
Sequence:CCGGCCTTGATTCTCTGTCGGAAGACTCGAGTCTTCCGACAGAGAATCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177778.3-881s1c1
Sequence:CCGGCCACAGGTATAGGAAGCAGAACTCGAGTTCTGCTTCCTATACCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177778
VALIDATED
ARMC7 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing 7
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177778.4-1826s21c1
Sequence:CCGGCGGCCCAACCTCTAATCTAATCTCGAGATTAGATTAGAGGTTGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177778.4-471s21c1
Sequence:CCGGGAAACCCTAATCAAGTTTGCTCTCGAGAGCAAACTTGATTAGGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177778.4-739s21c1
Sequence:CCGGCCCAGATATTCCTAGAGGACTCTCGAGAGTCCTCTAGGAATATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177778.4-423s21c1
Sequence:CCGGCAACTACAAGTCCTGGACTTACTCGAGTAAGTCCAGGACTTGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177778.3-1825s1c1
Sequence:CCGGCGGCCCAACCTCTAATCTAATCTCGAGATTAGATTAGAGGTTGGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177778.3-423s1c1
Sequence:CCGGCAACTACAAGTCCTGGACTTACTCGAGTAAGTCCAGGACTTGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177778.3-471s1c1
Sequence:CCGGGAAACCCTAATCAAGTTTGCTCTCGAGAGCAAACTTGATTAGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177778.3-739s1c1
Sequence:CCGGCCCAGATATTCCTAGAGGACTCTCGAGAGTCCTCTAGGAATATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177778.3-411s1c1
Sequence:CCGGCAGTACCTACGGCAACTACAACTCGAGTTGTAGTTGCCGTAGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177778.3-446s1c1
Sequence:CCGGCCTTGATTCTCTGTCGGAAGACTCGAGTCTTCCGACAGAGAATCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177778.3-881s1c1
Sequence:CCGGCCACAGGTATAGGAAGCAGAACTCGAGTTCTGCTTCCTATACCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024585
VALIDATED
ARMC7 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing 7
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_024585.2-1006s21c1
Sequence:CCGGCATCTGAAAGGCGGGTTCTTTCTCGAGAAAGAACCCGCCTTTCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_024585.2-1267s21c1
Sequence:CCGGCTGCAGGAAATCAGGGATTATCTCGAGATAATCCCTGATTTCCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_024585.2-1125s21c1
Sequence:CCGGCTGGCACTCTCAATCCTACATCTCGAGATGTAGGATTGAGAGTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024585.2-1690s21c1
Sequence:CCGGCCTCTGCTGTCACTCAATGATCTCGAGATCATTGAGTGACAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_024585.2-1295s21c1
Sequence:CCGGCAGAAGTGTCTGGAGTAGTTTCTCGAGAAACTACTCCAGACACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_024585.2-1295s1c1
Sequence:CCGGCAGAAGTGTCTGGAGTAGTTTCTCGAGAAACTACTCCAGACACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139759    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024585.2-1125s1c1
Sequence:CCGGCTGGCACTCTCAATCCTACATCTCGAGATGTAGGATTGAGAGTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024585.2-1288s1c1
Sequence:CCGGCCCTTAACAGAAGTGTCTGGACTCGAGTCCAGACACTTCTGTTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139716    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_024585.2-1690s1c1
Sequence:CCGGCCTCTGCTGTCACTCAATGATCTCGAGATCATTGAGTGACAGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139889    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024585.2-1266s1c1
Sequence:CCGGGCTGCAGGAAATCAGGGATTACTCGAGTAATCCCTGATTTCCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024585.2-1507s1c1
Sequence:CCGGCCATGACTCCAAGATGAAGATCTCGAGATCTTCATCTTGGAGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140332    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024585.2-1006s1c1
Sequence:CCGGCATCTGAAAGGCGGGTTCTTTCTCGAGAAAGAACCCGCCTTTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141082    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_024585.2-1267s1c1
Sequence:CCGGCTGCAGGAAATCAGGGATTATCTCGAGATAATCCCTGATTTCCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_024585.2-650s1c1
Sequence:CCGGGTCTGCCATCACCACGCTCATCTCGAGATGAGCGTGGTGATGGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024585
VALIDATED
ARMC7 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing 7
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_024585.2-1006s21c1
Sequence:CCGGCATCTGAAAGGCGGGTTCTTTCTCGAGAAAGAACCCGCCTTTCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_024585.2-1267s21c1
Sequence:CCGGCTGCAGGAAATCAGGGATTATCTCGAGATAATCCCTGATTTCCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_024585.2-1125s21c1
Sequence:CCGGCTGGCACTCTCAATCCTACATCTCGAGATGTAGGATTGAGAGTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024585.2-1690s21c1
Sequence:CCGGCCTCTGCTGTCACTCAATGATCTCGAGATCATTGAGTGACAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_024585.2-1295s21c1
Sequence:CCGGCAGAAGTGTCTGGAGTAGTTTCTCGAGAAACTACTCCAGACACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_024585.2-1295s1c1
Sequence:CCGGCAGAAGTGTCTGGAGTAGTTTCTCGAGAAACTACTCCAGACACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139759    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024585.2-1125s1c1
Sequence:CCGGCTGGCACTCTCAATCCTACATCTCGAGATGTAGGATTGAGAGTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024585.2-1288s1c1
Sequence:CCGGCCCTTAACAGAAGTGTCTGGACTCGAGTCCAGACACTTCTGTTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139716    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_024585.2-1690s1c1
Sequence:CCGGCCTCTGCTGTCACTCAATGATCTCGAGATCATTGAGTGACAGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139889    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024585.2-1266s1c1
Sequence:CCGGGCTGCAGGAAATCAGGGATTACTCGAGTAATCCCTGATTTCCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024585.2-1507s1c1
Sequence:CCGGCCATGACTCCAAGATGAAGATCTCGAGATCTTCATCTTGGAGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140332    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024585.2-1006s1c1
Sequence:CCGGCATCTGAAAGGCGGGTTCTTTCTCGAGAAAGAACCCGCCTTTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141082    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_024585.2-1267s1c1
Sequence:CCGGCTGCAGGAAATCAGGGATTATCTCGAGATAATCCCTGATTTCCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_024585.2-650s1c1
Sequence:CCGGGTCTGCCATCACCACGCTCATCTCGAGATGAGCGTGGTGATGGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024585
VALIDATED
ARMC7 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing 7
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_024585.2-1006s21c1
Sequence:CCGGCATCTGAAAGGCGGGTTCTTTCTCGAGAAAGAACCCGCCTTTCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_024585.2-1267s21c1
Sequence:CCGGCTGCAGGAAATCAGGGATTATCTCGAGATAATCCCTGATTTCCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_024585.2-1125s21c1
Sequence:CCGGCTGGCACTCTCAATCCTACATCTCGAGATGTAGGATTGAGAGTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024585.2-1690s21c1
Sequence:CCGGCCTCTGCTGTCACTCAATGATCTCGAGATCATTGAGTGACAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_024585.2-1295s21c1
Sequence:CCGGCAGAAGTGTCTGGAGTAGTTTCTCGAGAAACTACTCCAGACACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_024585.2-1295s1c1
Sequence:CCGGCAGAAGTGTCTGGAGTAGTTTCTCGAGAAACTACTCCAGACACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139759    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024585.2-1125s1c1
Sequence:CCGGCTGGCACTCTCAATCCTACATCTCGAGATGTAGGATTGAGAGTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024585.2-1288s1c1
Sequence:CCGGCCCTTAACAGAAGTGTCTGGACTCGAGTCCAGACACTTCTGTTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139716    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_024585.2-1690s1c1
Sequence:CCGGCCTCTGCTGTCACTCAATGATCTCGAGATCATTGAGTGACAGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139889    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024585.2-1266s1c1
Sequence:CCGGGCTGCAGGAAATCAGGGATTACTCGAGTAATCCCTGATTTCCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024585.2-1507s1c1
Sequence:CCGGCCATGACTCCAAGATGAAGATCTCGAGATCTTCATCTTGGAGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140332    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024585.2-1006s1c1
Sequence:CCGGCATCTGAAAGGCGGGTTCTTTCTCGAGAAAGAACCCGCCTTTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141082    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_024585.2-1267s1c1
Sequence:CCGGCTGCAGGAAATCAGGGATTATCTCGAGATAATCCCTGATTTCCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_024585.2-650s1c1
Sequence:CCGGGTCTGCCATCACCACGCTCATCTCGAGATGAGCGTGGTGATGGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks