EMAIL THIS PAGE TO A FRIEND

ARMC8

armadillo repeat containing 8

240 Gene Product Result for
Synonyms: GID5 HSPC056 VID28
Gene ID:
Mouse(74125) armadillo repeat containing 8
Rat(315949) armadillo repeat containing 8
naked mole-rat(101707861) armadillo repeat containing 8
domestic guinea pig(100726871) armadillo repeat containing 8
sheep(101111147) armadillo repeat containing 8
Domestic Rabbit(100355309) armadillo repeat containing 8
Zebrafish(571528) armadillo repeat containing 8
dog(485684) armadillo repeat containing 8
domestic cat(101093041) armadillo repeat containing 8
Horse(100066776) armadillo repeat containing 8
cow(539591) armadillo repeat containing 8
chicken(424731) armadillo repeat containing 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028768 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028768 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028768 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014154 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014154 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014154 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014154 Rosetta Predictions human pricing
NM_015396 Rosetta Predictions human pricing
NM_213654 Rosetta Predictions human pricing
XM_236599 Rosetta Predictions rat pricing
XR_008722 Rosetta Predictions rat pricing
NM_028768 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105325 predicted 1134
2 SASI_Hs01_00105326 predicted 1052
3 SASI_Hs01_00105327 predicted 809
4 SASI_Hs01_00105328 predicted 628
5 SASI_Hs01_00105329 predicted 1053
6 SASI_Hs01_00105331 predicted 1013
7 SASI_Hs01_00105332 predicted 925
8 SASI_Hs02_00345144 predicted 944
9 SASI_Hs01_00105334 predicted 804
10 SASI_Hs02_00345145 predicted 1183
11 SASI_Hs01_00105330 predicted 850
12 SASI_Hs01_00105333 predicted 793
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015396 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090903 predicted 1136
2 SASI_Hs01_00090904 predicted 1060
3 SASI_Hs01_00090905 predicted 813
4 SASI_Hs01_00090906 predicted 636
5 SASI_Hs01_00090907 predicted 1052
6 SASI_Hs01_00090909 predicted 1014
7 SASI_Hs01_00090910 predicted 925
8 SASI_Hs02_00347755 predicted 517
9 SASI_Hs02_00347756 predicted 941
10 SASI_Hs01_00090912 predicted 803
11 SASI_Hs01_00090908 predicted 847
12 SASI_Hs01_00090911 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213654 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017614 predicted 1188
2 SASI_Hs01_00017615 predicted 1109
3 SASI_Hs01_00017616 predicted 864
4 SASI_Hs01_00017617 predicted 685
5 SASI_Hs01_00017618 predicted 1105
6 SASI_Hs01_00017620 predicted 1061
7 SASI_Hs01_00017621 predicted 981
8 SASI_Hs02_00374342 predicted 571
9 SASI_Hs02_00374343 predicted 999
10 SASI_Hs01_00017623 predicted 858
11 SASI_Hs01_00017619 predicted 899
12 SASI_Hs01_00017622 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236599 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390209 predicted 991
2 SASI_Rn02_00390210 predicted 1800
3 SASI_Rn02_00390211 predicted 2078
4 SASI_Rn02_00390212 predicted 1487
5 SASI_Rn02_00390213 predicted 1075
6 SASI_Rn02_00390214 predicted 1473
7 SASI_Rn02_00390215 predicted 1827
8 SASI_Rn02_00390216 predicted 2006
9 SASI_Rn02_00390217 predicted 1925
10 SASI_Rn02_00390218 predicted 1601
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008722 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00145157 predicted 1727
2 SASI_Rn01_00145158 predicted 985
3 SASI_Rn01_00145159 predicted 1801
4 SASI_Rn01_00145160 predicted 1512
5 SASI_Rn01_00145161 predicted 1069
6 SASI_Rn02_00417742 predicted 781
7 SASI_Rn01_00145162 predicted 1829
8 SASI_Rn01_00145163 predicted 2003
9 SASI_Rn01_00145164 predicted 1921
10 SASI_Rn01_00145165 predicted 1602
11 SASI_Rn01_00145156 predicted 1000
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028768 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087016 predicted 1112
2 SASI_Mm01_00087017 predicted 1123
3 SASI_Mm01_00087018 predicted 1563
4 SASI_Mm01_00087019 predicted 1475
5 SASI_Mm01_00087020 predicted 1786
6 SASI_Mm01_00087021 predicted 552
7 SASI_Mm01_00087022 predicted 972
8 SASI_Mm01_00087023 predicted 831
9 SASI_Mm01_00087024 predicted 847
10 SASI_Mm01_00087025 predicted 1456
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028768
VALIDATED
ARMC8 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing 8
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028768.1-1167s1c1
Sequence:CCGGGCCTATCTGATTGAGCCAGATCTCGAGATCTGGCTCAATCAGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191250    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028768.1-2422s1c1
Sequence:CCGGCGGATTCATCTTGAGAACATTCTCGAGAATGTTCTCAAGATGAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202125    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028768.1-2465s1c1
Sequence:CCGGCGAGGACTGTTGTGTTGTGTTCTCGAGAACACAACACAACAGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028768.2-2533s21c1
Sequence:CCGGATTTCCTTTGGACCTACAATTCTCGAGAATTGTAGGTCCAAAGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028768.2-733s21c1
Sequence:CCGGCCGCTACACCCAGGAGTATATCTCGAGATATACTCCTGGGTGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028768.2-1793s1c1
Sequence:CCGGGAACAGTTATTCCGGTTATTGCTCGAGCAATAACCGGAATAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028768.2-1792s21c1
Sequence:CCGGTGAACAGTTATTCCGGTTATTCTCGAGAATAACCGGAATAACTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028768.2-1228s21c1
Sequence:CCGGTGCCATGCTGGCTGACTATTTCTCGAGAAATAGTCAGCCAGCATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028768.2-553s21c1
Sequence:CCGGTCTACTAGACTGCCATATTATCTCGAGATAATATGGCAGTCTAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028768
VALIDATED
ARMC8 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing 8
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028768.1-1167s1c1
Sequence:CCGGGCCTATCTGATTGAGCCAGATCTCGAGATCTGGCTCAATCAGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191250    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028768.1-2422s1c1
Sequence:CCGGCGGATTCATCTTGAGAACATTCTCGAGAATGTTCTCAAGATGAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202125    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028768.1-2465s1c1
Sequence:CCGGCGAGGACTGTTGTGTTGTGTTCTCGAGAACACAACACAACAGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028768.2-2533s21c1
Sequence:CCGGATTTCCTTTGGACCTACAATTCTCGAGAATTGTAGGTCCAAAGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028768.2-733s21c1
Sequence:CCGGCCGCTACACCCAGGAGTATATCTCGAGATATACTCCTGGGTGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028768.2-1793s1c1
Sequence:CCGGGAACAGTTATTCCGGTTATTGCTCGAGCAATAACCGGAATAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028768.2-1792s21c1
Sequence:CCGGTGAACAGTTATTCCGGTTATTCTCGAGAATAACCGGAATAACTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028768.2-1228s21c1
Sequence:CCGGTGCCATGCTGGCTGACTATTTCTCGAGAAATAGTCAGCCAGCATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028768.2-553s21c1
Sequence:CCGGTCTACTAGACTGCCATATTATCTCGAGATAATATGGCAGTCTAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028768
VALIDATED
ARMC8 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing 8
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028768.1-1167s1c1
Sequence:CCGGGCCTATCTGATTGAGCCAGATCTCGAGATCTGGCTCAATCAGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191250    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028768.1-2422s1c1
Sequence:CCGGCGGATTCATCTTGAGAACATTCTCGAGAATGTTCTCAAGATGAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202125    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028768.1-2465s1c1
Sequence:CCGGCGAGGACTGTTGTGTTGTGTTCTCGAGAACACAACACAACAGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028768.2-2533s21c1
Sequence:CCGGATTTCCTTTGGACCTACAATTCTCGAGAATTGTAGGTCCAAAGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028768.2-733s21c1
Sequence:CCGGCCGCTACACCCAGGAGTATATCTCGAGATATACTCCTGGGTGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028768.2-1793s1c1
Sequence:CCGGGAACAGTTATTCCGGTTATTGCTCGAGCAATAACCGGAATAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028768.2-1792s21c1
Sequence:CCGGTGAACAGTTATTCCGGTTATTCTCGAGAATAACCGGAATAACTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028768.2-1228s21c1
Sequence:CCGGTGCCATGCTGGCTGACTATTTCTCGAGAAATAGTCAGCCAGCATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028768.2-553s21c1
Sequence:CCGGTCTACTAGACTGCCATATTATCTCGAGATAATATGGCAGTCTAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014154
ARMC8 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014154.1-826s1c1
Sequence:CCGGGTGAAGATGTTACAGAGGGATCTCGAGATCCCTCTGTAACATCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014154.1-727s1c1
Sequence:CCGGGCACTGAAATGTTTCTCAGTTCTCGAGAACTGAGAAACATTTCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014154.1-803s1c1
Sequence:CCGGGAGAATTGTTACCACAGATTTCTCGAGAAATCTGTGGTAACAATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014154.1-913s1c1
Sequence:CCGGCGGACAGATGATAACTGTATTCTCGAGAATACAGTTATCATCTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014154.2-947s21c1
Sequence:CCGGGCACTGAAATGTTTCTCAGTTCTCGAGAACTGAGAAACATTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014154.2-1046s21c1
Sequence:CCGGGTGAAGATGTTACAGAGGGATCTCGAGATCCCTCTGTAACATCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014154.2-1133s21c1
Sequence:CCGGCGGACAGATGATAACTGTATTCTCGAGAATACAGTTATCATCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014154.2-1023s21c1
Sequence:CCGGGAGAATTGTTACCACAGATTTCTCGAGAAATCTGTGGTAACAATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014154
ARMC8 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014154.1-826s1c1
Sequence:CCGGGTGAAGATGTTACAGAGGGATCTCGAGATCCCTCTGTAACATCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014154.1-727s1c1
Sequence:CCGGGCACTGAAATGTTTCTCAGTTCTCGAGAACTGAGAAACATTTCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014154.1-803s1c1
Sequence:CCGGGAGAATTGTTACCACAGATTTCTCGAGAAATCTGTGGTAACAATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014154.1-913s1c1
Sequence:CCGGCGGACAGATGATAACTGTATTCTCGAGAATACAGTTATCATCTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014154.2-947s21c1
Sequence:CCGGGCACTGAAATGTTTCTCAGTTCTCGAGAACTGAGAAACATTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014154.2-1046s21c1
Sequence:CCGGGTGAAGATGTTACAGAGGGATCTCGAGATCCCTCTGTAACATCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014154.2-1133s21c1
Sequence:CCGGCGGACAGATGATAACTGTATTCTCGAGAATACAGTTATCATCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014154.2-1023s21c1
Sequence:CCGGGAGAATTGTTACCACAGATTTCTCGAGAAATCTGTGGTAACAATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014154
ARMC8 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014154.1-826s1c1
Sequence:CCGGGTGAAGATGTTACAGAGGGATCTCGAGATCCCTCTGTAACATCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014154.1-727s1c1
Sequence:CCGGGCACTGAAATGTTTCTCAGTTCTCGAGAACTGAGAAACATTTCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014154.1-803s1c1
Sequence:CCGGGAGAATTGTTACCACAGATTTCTCGAGAAATCTGTGGTAACAATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014154.1-913s1c1
Sequence:CCGGCGGACAGATGATAACTGTATTCTCGAGAATACAGTTATCATCTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014154.2-947s21c1
Sequence:CCGGGCACTGAAATGTTTCTCAGTTCTCGAGAACTGAGAAACATTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014154.2-1046s21c1
Sequence:CCGGGTGAAGATGTTACAGAGGGATCTCGAGATCCCTCTGTAACATCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014154.2-1133s21c1
Sequence:CCGGCGGACAGATGATAACTGTATTCTCGAGAATACAGTTATCATCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014154.2-1023s21c1
Sequence:CCGGGAGAATTGTTACCACAGATTTCTCGAGAAATCTGTGGTAACAATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks