EMAIL THIS PAGE TO A FRIEND

ARMC9

armadillo repeat containing 9

72 Gene Product Result for
Synonyms: ARM KU-MEL-1
Gene ID:
Mouse(78795) armadillo repeat containing 9
Rat(301579) armadillo repeat containing 9
chicken(424929) armadillo repeat containing 9
cow(536462) armadillo repeat containing 9
Horse(100064101) armadillo repeat containing 9
domestic cat(101096003) armadillo repeat containing 9
dog(477407) armadillo repeat containing 9
sheep(101107335) armadillo repeat containing 9
domestic guinea pig(100735953) armadillo repeat containing 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025139 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025139 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025139 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027507 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027507 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027507 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025139 Rosetta Predictions human pricing
NM_001109663 Rosetta Predictions rat pricing
NM_027456 Rosetta Predictions mouse pricing
NM_027507 Rosetta Predictions mouse pricing
NM_030184 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025139 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186215 predicted 1633
2 SASI_Hs01_00186216 predicted 891
3 SASI_Hs01_00186217 predicted 1100
4 SASI_Hs01_00186218 predicted 245
5 SASI_Hs01_00186219 predicted 1474
6 SASI_Hs01_00186220 predicted 283
7 SASI_Hs01_00186221 predicted 351
8 SASI_Hs01_00186222 predicted 1626
9 SASI_Hs01_00186223 predicted 1613
10 SASI_Hs02_00357865 predicted 764
11 SASI_Hs01_00186224 predicted 792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109663 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250492 predicted 308
2 SASI_Rn02_00250493 predicted 1010
3 SASI_Rn02_00250494 predicted 1604
4 SASI_Rn02_00250495 predicted 334
5 SASI_Rn02_00250496 predicted 1895
6 SASI_Rn02_00250497 predicted 1747
7 SASI_Rn02_00250498 predicted 336
8 SASI_Rn02_00250499 predicted 453
9 SASI_Rn02_00250500 predicted 1762
10 SASI_Rn02_00250501 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027456 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332236 predicted 231
2 SASI_Mm02_00332237 predicted 1059
3 SASI_Mm02_00332238 predicted 241
4 SASI_Mm02_00332239 predicted 1154
5 SASI_Mm02_00332240 predicted 1574
6 SASI_Mm02_00332241 predicted 1475
7 SASI_Mm02_00332242 predicted 1747
8 SASI_Mm02_00332243 predicted 417
9 SASI_Mm02_00332244 predicted 309
10 SASI_Mm02_00332245 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027507 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155657 predicted 2314
2 SASI_Mm01_00155658 predicted 226
3 SASI_Mm01_00155659 predicted 1049
4 SASI_Mm01_00155660 predicted 232
5 SASI_Mm01_00155661 predicted 1153
6 SASI_Mm01_00155662 predicted 1562
7 SASI_Mm01_00155663 predicted 1470
8 SASI_Mm01_00155664 predicted 1735
9 SASI_Mm01_00155665 predicted 410
10 SASI_Mm01_00155666 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030184 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146823 predicted 262
2 SASI_Mm01_00146824 predicted 1094
3 SASI_Mm01_00146825 predicted 278
4 SASI_Mm01_00146826 predicted 1192
5 SASI_Mm01_00146827 predicted 1604
6 SASI_Mm01_00146828 predicted 1514
7 SASI_Mm01_00146829 predicted 1786
8 SASI_Mm01_00146830 predicted 444
9 SASI_Mm01_00146831 predicted 342
10 SASI_Mm02_00336603 predicted 661
11 SASI_Mm01_00146822 predicted 2349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025139
VALIDATED
ARMC9 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing 9
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025139.3-291s21c1
Sequence:CCGGAGGATCTTGTCGCTGCATTTGCTCGAGCAAATGCAGCGACAAGATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025139.3-266s21c1
Sequence:CCGGGACTCCAAATCATTGACAATTCTCGAGAATTGTCAATGATTTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025139.3-706s21c1
Sequence:CCGGATATAAGGAGAATGGACAAAGCTCGAGCTTTGTCCATTCTCCTTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_025139.2-1159s1c1
Sequence:CCGGCAATGACCTCTTGGACTGTTACTCGAGTAACAGTCCAAGAGGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025139.2-593s1c1
Sequence:CCGGGAGTTAAAGTTGAAGTTGGAACTCGAGTTCCAACTTCAACTTTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025139.2-1592s1c1
Sequence:CCGGCTTTCGGATCTTCTTGGCCATCTCGAGATGGCCAAGAAGATCCGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_025139.2-1742s1c1
Sequence:CCGGGCTGAAATGATCCGCCAGATACTCGAGTATCTGGCGGATCATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_025139.2-1618s1c1
Sequence:CCGGCCATGAGATACAGCCGTATGTCTCGAGACATACGGCTGTATCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_025139.2-1777s1c1
Sequence:CCGGGCAGCTAAATTCCGAAGAGCTCTCGAGAGCTCTTCGGAATTTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025139
VALIDATED
ARMC9 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing 9
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025139.3-291s21c1
Sequence:CCGGAGGATCTTGTCGCTGCATTTGCTCGAGCAAATGCAGCGACAAGATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025139.3-266s21c1
Sequence:CCGGGACTCCAAATCATTGACAATTCTCGAGAATTGTCAATGATTTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025139.3-706s21c1
Sequence:CCGGATATAAGGAGAATGGACAAAGCTCGAGCTTTGTCCATTCTCCTTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_025139.2-1159s1c1
Sequence:CCGGCAATGACCTCTTGGACTGTTACTCGAGTAACAGTCCAAGAGGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025139.2-593s1c1
Sequence:CCGGGAGTTAAAGTTGAAGTTGGAACTCGAGTTCCAACTTCAACTTTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025139.2-1592s1c1
Sequence:CCGGCTTTCGGATCTTCTTGGCCATCTCGAGATGGCCAAGAAGATCCGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_025139.2-1742s1c1
Sequence:CCGGGCTGAAATGATCCGCCAGATACTCGAGTATCTGGCGGATCATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_025139.2-1618s1c1
Sequence:CCGGCCATGAGATACAGCCGTATGTCTCGAGACATACGGCTGTATCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_025139.2-1777s1c1
Sequence:CCGGGCAGCTAAATTCCGAAGAGCTCTCGAGAGCTCTTCGGAATTTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025139
VALIDATED
ARMC9 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing 9
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025139.3-291s21c1
Sequence:CCGGAGGATCTTGTCGCTGCATTTGCTCGAGCAAATGCAGCGACAAGATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025139.3-266s21c1
Sequence:CCGGGACTCCAAATCATTGACAATTCTCGAGAATTGTCAATGATTTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025139.3-706s21c1
Sequence:CCGGATATAAGGAGAATGGACAAAGCTCGAGCTTTGTCCATTCTCCTTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_025139.2-1159s1c1
Sequence:CCGGCAATGACCTCTTGGACTGTTACTCGAGTAACAGTCCAAGAGGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025139.2-593s1c1
Sequence:CCGGGAGTTAAAGTTGAAGTTGGAACTCGAGTTCCAACTTCAACTTTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025139.2-1592s1c1
Sequence:CCGGCTTTCGGATCTTCTTGGCCATCTCGAGATGGCCAAGAAGATCCGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_025139.2-1742s1c1
Sequence:CCGGGCTGAAATGATCCGCCAGATACTCGAGTATCTGGCGGATCATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_025139.2-1618s1c1
Sequence:CCGGCCATGAGATACAGCCGTATGTCTCGAGACATACGGCTGTATCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_025139.2-1777s1c1
Sequence:CCGGGCAGCTAAATTCCGAAGAGCTCTCGAGAGCTCTTCGGAATTTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027507
ARMC9 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing 9
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027507.1-2049s1c1
Sequence:CCGGGTGCTAGGAGACCATCTCATTCTCGAGAATGAGATGGTCTCCTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027507.1-1001s1c1
Sequence:CCGGCCTGGATTATGAGAAGCTGAACTCGAGTTCAGCTTCTCATAATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027507.1-576s1c1
Sequence:CCGGGAATTAAAGCTGAAGCTGGAACTCGAGTTCCAGCTTCAGCTTTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201441    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027507.1-3172s1c1
Sequence:CCGGCCACGCTATAAACCTTGCTAACTCGAGTTAGCAAGGTTTATAGCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027507
ARMC9 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing 9
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027507.1-2049s1c1
Sequence:CCGGGTGCTAGGAGACCATCTCATTCTCGAGAATGAGATGGTCTCCTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027507.1-1001s1c1
Sequence:CCGGCCTGGATTATGAGAAGCTGAACTCGAGTTCAGCTTCTCATAATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027507.1-576s1c1
Sequence:CCGGGAATTAAAGCTGAAGCTGGAACTCGAGTTCCAGCTTCAGCTTTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201441    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027507.1-3172s1c1
Sequence:CCGGCCACGCTATAAACCTTGCTAACTCGAGTTAGCAAGGTTTATAGCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027507
ARMC9 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing 9
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027507.1-2049s1c1
Sequence:CCGGGTGCTAGGAGACCATCTCATTCTCGAGAATGAGATGGTCTCCTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027507.1-1001s1c1
Sequence:CCGGCCTGGATTATGAGAAGCTGAACTCGAGTTCAGCTTCTCATAATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027507.1-576s1c1
Sequence:CCGGGAATTAAAGCTGAAGCTGGAACTCGAGTTCCAGCTTCAGCTTTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201441    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027507.1-3172s1c1
Sequence:CCGGCCACGCTATAAACCTTGCTAACTCGAGTTAGCAAGGTTTATAGCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks