EMAIL THIS PAGE TO A FRIEND

ARMCX2

armadillo repeat containing, X-linked 2

109 Gene Product Result for
Synonyms: ALEX2
UniProtKB ID: Q7L311, O60267, Q5H9D9
Gene ID:
Human(9823) Summary: This gene encodes a member of the ALEX family of proteins and may play a role in tumor suppression. The encoded protein contains a potential N-terminal transmembrane domain and a single Armadillo (arm) repeat. Other proteins containing the arm repeat are involved in development, maintenance of tissue integrity, and tumorigenesis. This gene is closely localized with other family members, including ALEX1 and ALEX3, on the X chromosome. Two alternative transcripts that encode the same protein but differ in the 5' UTR have been described. Additional alternative transcripts may exist but their full length natures have not been determined. A pseudogene for this locus is located on chromosome 7. [provided by RefSeq, Jul 2008]
Mouse(67416) armadillo repeat containing, X-linked 2
Rat(367903) armadillo repeat containing, X-linked 2
dog(100687956) armadillo repeat containing, X-linked 2
domestic cat(101089335) armadillo repeat containing, X-linked 2
cow(767841) armadillo repeat containing, X-linked 2
sheep(101108027) armadillo repeat containing, X-linked 2
domestic guinea pig(100718122) armadillo repeat containing, X-linked 2
naked mole-rat(101709635) armadillo repeat containing, X-linked 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026139 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026139 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026139 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014782 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014782 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014782 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU089181 MISSION® esiRNA esiRNA human ARMCX2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014782 Rosetta Predictions human pricing
NM_177949 Rosetta Predictions human pricing
NM_001014274 Rosetta Predictions rat pricing
NM_026139 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014782 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056943 predicted 1929
2 SASI_Hs01_00056944 predicted 2195
3 SASI_Hs01_00056945 predicted 1705
4 SASI_Hs02_00346281 predicted 2006
5 SASI_Hs01_00056946 predicted 1823
6 SASI_Hs01_00056947 predicted 1380
7 SASI_Hs01_00056948 predicted 1627
8 SASI_Hs01_00056949 predicted 2372
9 SASI_Hs02_00346282 predicted 2158
10 SASI_Hs01_00056950 predicted 1831
11 SASI_Hs01_00056951 predicted 2357
12 SASI_Hs01_00056952 predicted 2090
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177949 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020431 predicted 1984
2 SASI_Hs01_00020432 predicted 2241
3 SASI_Hs01_00020433 predicted 1755
4 SASI_Hs02_00369430 predicted 2052
5 SASI_Hs01_00020434 predicted 1878
6 SASI_Hs01_00020435 predicted 1432
7 SASI_Hs01_00020436 predicted 1672
8 SASI_Hs01_00020437 predicted 2425
9 SASI_Hs02_00369431 predicted 2209
10 SASI_Hs01_00020438 predicted 1886
11 SASI_Hs01_00020439 predicted 2410
12 SASI_Hs01_00020440 predicted 2136
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014274 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073976 predicted 754
2 SASI_Rn02_00201848 predicted 3004
3 SASI_Rn01_00073978 predicted 2946
4 SASI_Rn01_00073979 predicted 2683
5 SASI_Rn01_00073980 predicted 2346
6 SASI_Rn01_00073981 predicted 2097
7 SASI_Rn01_00073982 predicted 2753
8 SASI_Rn02_00201849 predicted 2247
9 SASI_Rn01_00073983 predicted 2990
10 SASI_Rn01_00073985 predicted 2716
11 SASI_Rn01_00073977 predicted 2251
12 SASI_Rn01_00073984 predicted 2921
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026139 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068544 predicted 1196
2 SASI_Mm01_00068545 predicted 2968
3 SASI_Mm02_00329746 predicted 2739
4 SASI_Mm02_00329747 predicted 2777
5 SASI_Mm01_00068546 predicted 2949
6 SASI_Mm01_00068547 predicted 2288
7 SASI_Mm01_00068548 predicted 3177
8 SASI_Mm01_00068549 predicted 1405
9 SASI_Mm01_00068550 predicted 3018
10 SASI_Mm01_00068551 predicted 2607
11 SASI_Mm01_00068552 predicted 3220
12 SASI_Mm01_00068553 predicted 3254
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026139
VALIDATED
ARMCX2 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing, X-linked 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026139.3-2975s21c1
Sequence:CCGGCCCTTACTCTATTTGAGATTACTCGAGTAATCTCAAATAGAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026139.3-869s21c1
Sequence:CCGGCCTGGTACTGTGTCTACAAATCTCGAGATTTGTAGACACAGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026139.3-1117s21c1
Sequence:CCGGCCCAGTCCTAAGGTTCAGAATCTCGAGATTCTGAACCTTAGGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026139.3-3320s21c1
Sequence:CCGGCCAGCTTTAAGCTGAACCATTCTCGAGAATGGTTCAGCTTAAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125849    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026139.2-3321s1c1
Sequence:CCGGCCAGCTTTAAGCTGAACCATTCTCGAGAATGGTTCAGCTTAAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026139.2-2919s1c1
Sequence:CCGGCGTCATCATTTAGTTCCCTTTCTCGAGAAAGGGAACTAAATGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026139.2-2976s1c1
Sequence:CCGGCCCTTACTCTATTTGAGATTACTCGAGTAATCTCAAATAGAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026139.2-870s1c1
Sequence:CCGGCCTGGTACTGTGTCTACAAATCTCGAGATTTGTAGACACAGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026139.2-1118s1c1
Sequence:CCGGCCCAGTCCTAAGGTTCAGAATCTCGAGATTCTGAACCTTAGGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026139
VALIDATED
ARMCX2 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing, X-linked 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026139.3-2975s21c1
Sequence:CCGGCCCTTACTCTATTTGAGATTACTCGAGTAATCTCAAATAGAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026139.3-869s21c1
Sequence:CCGGCCTGGTACTGTGTCTACAAATCTCGAGATTTGTAGACACAGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026139.3-1117s21c1
Sequence:CCGGCCCAGTCCTAAGGTTCAGAATCTCGAGATTCTGAACCTTAGGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026139.3-3320s21c1
Sequence:CCGGCCAGCTTTAAGCTGAACCATTCTCGAGAATGGTTCAGCTTAAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125849    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026139.2-3321s1c1
Sequence:CCGGCCAGCTTTAAGCTGAACCATTCTCGAGAATGGTTCAGCTTAAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026139.2-2919s1c1
Sequence:CCGGCGTCATCATTTAGTTCCCTTTCTCGAGAAAGGGAACTAAATGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026139.2-2976s1c1
Sequence:CCGGCCCTTACTCTATTTGAGATTACTCGAGTAATCTCAAATAGAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026139.2-870s1c1
Sequence:CCGGCCTGGTACTGTGTCTACAAATCTCGAGATTTGTAGACACAGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026139.2-1118s1c1
Sequence:CCGGCCCAGTCCTAAGGTTCAGAATCTCGAGATTCTGAACCTTAGGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026139
VALIDATED
ARMCX2 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing, X-linked 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026139.3-2975s21c1
Sequence:CCGGCCCTTACTCTATTTGAGATTACTCGAGTAATCTCAAATAGAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026139.3-869s21c1
Sequence:CCGGCCTGGTACTGTGTCTACAAATCTCGAGATTTGTAGACACAGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026139.3-1117s21c1
Sequence:CCGGCCCAGTCCTAAGGTTCAGAATCTCGAGATTCTGAACCTTAGGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026139.3-3320s21c1
Sequence:CCGGCCAGCTTTAAGCTGAACCATTCTCGAGAATGGTTCAGCTTAAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125849    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026139.2-3321s1c1
Sequence:CCGGCCAGCTTTAAGCTGAACCATTCTCGAGAATGGTTCAGCTTAAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026139.2-2919s1c1
Sequence:CCGGCGTCATCATTTAGTTCCCTTTCTCGAGAAAGGGAACTAAATGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026139.2-2976s1c1
Sequence:CCGGCCCTTACTCTATTTGAGATTACTCGAGTAATCTCAAATAGAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026139.2-870s1c1
Sequence:CCGGCCTGGTACTGTGTCTACAAATCTCGAGATTTGTAGACACAGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026139.2-1118s1c1
Sequence:CCGGCCCAGTCCTAAGGTTCAGAATCTCGAGATTCTGAACCTTAGGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014782
ARMCX2 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing, X-linked 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014782.4-1907s1c1
Sequence:CCGGGCAGTTCAAGTAGTTGGACTACTCGAGTAGTCCAACTACTTGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014782.4-1908s1c1
Sequence:CCGGCAGTTCAAGTAGTTGGACTAACTCGAGTTAGTCCAACTACTTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014782.4-2303s1c1
Sequence:CCGGCACCATGACCTCTTAGTGAAACTCGAGTTTCACTAAGAGGTCATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014782.4-2602s1c1
Sequence:CCGGCGTGCTGCTTGGATAGAAATACTCGAGTATTTCTATCCAAGCAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014782.4-2591s1c1
Sequence:CCGGGTGACTTTAATCGTGCTGCTTCTCGAGAAGCAGCACGATTAAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014782
ARMCX2 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing, X-linked 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014782.4-1907s1c1
Sequence:CCGGGCAGTTCAAGTAGTTGGACTACTCGAGTAGTCCAACTACTTGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014782.4-1908s1c1
Sequence:CCGGCAGTTCAAGTAGTTGGACTAACTCGAGTTAGTCCAACTACTTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014782.4-2303s1c1
Sequence:CCGGCACCATGACCTCTTAGTGAAACTCGAGTTTCACTAAGAGGTCATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014782.4-2602s1c1
Sequence:CCGGCGTGCTGCTTGGATAGAAATACTCGAGTATTTCTATCCAAGCAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014782.4-2591s1c1
Sequence:CCGGGTGACTTTAATCGTGCTGCTTCTCGAGAAGCAGCACGATTAAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014782
ARMCX2 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing, X-linked 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014782.4-1907s1c1
Sequence:CCGGGCAGTTCAAGTAGTTGGACTACTCGAGTAGTCCAACTACTTGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014782.4-1908s1c1
Sequence:CCGGCAGTTCAAGTAGTTGGACTAACTCGAGTTAGTCCAACTACTTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014782.4-2303s1c1
Sequence:CCGGCACCATGACCTCTTAGTGAAACTCGAGTTTCACTAAGAGGTCATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014782.4-2602s1c1
Sequence:CCGGCGTGCTGCTTGGATAGAAATACTCGAGTATTTCTATCCAAGCAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014782.4-2591s1c1
Sequence:CCGGGTGACTTTAATCGTGCTGCTTCTCGAGAAGCAGCACGATTAAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks