EMAIL THIS PAGE TO A FRIEND

ARMCX5

armadillo repeat containing, X-linked 5

56 Gene Product Result for
UniProtKB ID: Q6P1M9, B3KU88, D3DX99, Q68DB4, Q9BVZ3, Q9H969
Gene ID:
Mouse(494468) armadillo repeat containing, X-linked 5
Rat(100361182) armadillo repeat containing, X-linked 5
sheep(101122765) armadillo repeat containing, X-linked 5
cow(783344) armadillo repeat containing, X-linked 5
dog(480995) armadillo repeat containing, X-linked 5
domestic cat(101092012) armadillo repeat containing, X-linked 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022838 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022838 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022838 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001009575 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001009575 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001009575 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022838 Rosetta Predictions human pricing
NM_001009575 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103991 predicted 2615
2 SASI_Hs01_00103992 predicted 1548
3 SASI_Hs01_00103993 predicted 2312
4 SASI_Hs01_00103994 predicted 2224
5 SASI_Hs01_00103995 predicted 2206
6 SASI_Hs01_00103996 predicted 2005
7 SASI_Hs01_00103997 predicted 1092
8 SASI_Hs01_00103998 predicted 1659
9 SASI_Hs01_00103999 predicted 1271
10 SASI_Hs01_00104000 predicted 2103
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009575 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149407 predicted 2281
2 SASI_Mm01_00149408 predicted 1694
3 SASI_Mm01_00149409 predicted 1828
4 SASI_Mm01_00149410 predicted 2510
5 SASI_Mm01_00149411 predicted 2071
6 SASI_Mm01_00149412 predicted 1716
7 SASI_Mm01_00149413 predicted 1726
8 SASI_Mm01_00149414 predicted 2099
9 SASI_Mm01_00149415 predicted 1687
10 SASI_Mm01_00149416 predicted 1778
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022838
VALIDATED
ARMCX5 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing, X-linked 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022838.2-2569s21c1
Sequence:CCGGGAGATAAAGTCATACGATTAACTCGAGTTAATCGTATGACTTTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022838.2-2174s21c1
Sequence:CCGGACTAGGGCACTTGAGTATAAACTCGAGTTTATACTCAAGTGCCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022838.2-2207s21c1
Sequence:CCGGCTATGTGATTACCAGTTATATCTCGAGATATAACTGGTAATCACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022838.2-1729s21c1
Sequence:CCGGCACCTTATCATGGGCCTTATTCTCGAGAATAAGGCCCATGATAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022838.2-2608s1c1
Sequence:CCGGCCCTCTGTTCTCATAAAGCCTCTCGAGAGGCTTTATGAGAACAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022838.2-1751s1c1
Sequence:CCGGCCAGACCTTAGCTGAGATCAACTCGAGTTGATCTCAGCTAAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022838.2-1605s1c1
Sequence:CCGGGCCAGGTATATTGTCCTAGTTCTCGAGAACTAGGACAATATACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022838.2-2841s1c1
Sequence:CCGGCATCCTGAGTAAGCTATACTTCTCGAGAAGTATAGCTTACTCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022838.2-2315s1c1
Sequence:CCGGCGCCAATACAAGAGAATTGATCTCGAGATCAATTCTCTTGTATTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022838.2-2849s1c1
Sequence:CCGGGTAAGCTATACTTCTGTGCTTCTCGAGAAGCACAGAAGTATAGCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022838
VALIDATED
ARMCX5 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing, X-linked 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022838.2-2569s21c1
Sequence:CCGGGAGATAAAGTCATACGATTAACTCGAGTTAATCGTATGACTTTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022838.2-2174s21c1
Sequence:CCGGACTAGGGCACTTGAGTATAAACTCGAGTTTATACTCAAGTGCCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022838.2-2207s21c1
Sequence:CCGGCTATGTGATTACCAGTTATATCTCGAGATATAACTGGTAATCACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022838.2-1729s21c1
Sequence:CCGGCACCTTATCATGGGCCTTATTCTCGAGAATAAGGCCCATGATAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022838.2-2608s1c1
Sequence:CCGGCCCTCTGTTCTCATAAAGCCTCTCGAGAGGCTTTATGAGAACAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022838.2-1751s1c1
Sequence:CCGGCCAGACCTTAGCTGAGATCAACTCGAGTTGATCTCAGCTAAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022838.2-1605s1c1
Sequence:CCGGGCCAGGTATATTGTCCTAGTTCTCGAGAACTAGGACAATATACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022838.2-2841s1c1
Sequence:CCGGCATCCTGAGTAAGCTATACTTCTCGAGAAGTATAGCTTACTCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022838.2-2315s1c1
Sequence:CCGGCGCCAATACAAGAGAATTGATCTCGAGATCAATTCTCTTGTATTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022838.2-2849s1c1
Sequence:CCGGGTAAGCTATACTTCTGTGCTTCTCGAGAAGCACAGAAGTATAGCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022838
VALIDATED
ARMCX5 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing, X-linked 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022838.2-2569s21c1
Sequence:CCGGGAGATAAAGTCATACGATTAACTCGAGTTAATCGTATGACTTTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022838.2-2174s21c1
Sequence:CCGGACTAGGGCACTTGAGTATAAACTCGAGTTTATACTCAAGTGCCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022838.2-2207s21c1
Sequence:CCGGCTATGTGATTACCAGTTATATCTCGAGATATAACTGGTAATCACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022838.2-1729s21c1
Sequence:CCGGCACCTTATCATGGGCCTTATTCTCGAGAATAAGGCCCATGATAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022838.2-2608s1c1
Sequence:CCGGCCCTCTGTTCTCATAAAGCCTCTCGAGAGGCTTTATGAGAACAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022838.2-1751s1c1
Sequence:CCGGCCAGACCTTAGCTGAGATCAACTCGAGTTGATCTCAGCTAAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022838.2-1605s1c1
Sequence:CCGGGCCAGGTATATTGTCCTAGTTCTCGAGAACTAGGACAATATACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022838.2-2841s1c1
Sequence:CCGGCATCCTGAGTAAGCTATACTTCTCGAGAAGTATAGCTTACTCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022838.2-2315s1c1
Sequence:CCGGCGCCAATACAAGAGAATTGATCTCGAGATCAATTCTCTTGTATTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022838.2-2849s1c1
Sequence:CCGGGTAAGCTATACTTCTGTGCTTCTCGAGAAGCACAGAAGTATAGCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009575
ARMCX5 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing, X-linked 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009575.1-1154s1c1
Sequence:CCGGCGTTATTTCATCTCACTGTTACTCGAGTAACAGTGAGATGAAATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009575.1-482s1c1
Sequence:CCGGCCAGATACATTCGACTATGCTCTCGAGAGCATAGTCGAATGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009575.1-1448s1c1
Sequence:CCGGGACCAGAAACTCCAAGACTTACTCGAGTAAGTCTTGGAGTTTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009575.1-1442s1c1
Sequence:CCGGGAGTTTGACCAGAAACTCCAACTCGAGTTGGAGTTTCTGGTCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009575.1-750s1c1
Sequence:CCGGGCTGTAAATCCCGCACCTTTACTCGAGTAAAGGTGCGGGATTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009575
ARMCX5 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing, X-linked 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009575.1-1154s1c1
Sequence:CCGGCGTTATTTCATCTCACTGTTACTCGAGTAACAGTGAGATGAAATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009575.1-482s1c1
Sequence:CCGGCCAGATACATTCGACTATGCTCTCGAGAGCATAGTCGAATGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009575.1-1448s1c1
Sequence:CCGGGACCAGAAACTCCAAGACTTACTCGAGTAAGTCTTGGAGTTTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009575.1-1442s1c1
Sequence:CCGGGAGTTTGACCAGAAACTCCAACTCGAGTTGGAGTTTCTGGTCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009575.1-750s1c1
Sequence:CCGGGCTGTAAATCCCGCACCTTTACTCGAGTAAAGGTGCGGGATTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009575
ARMCX5 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing, X-linked 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009575.1-1154s1c1
Sequence:CCGGCGTTATTTCATCTCACTGTTACTCGAGTAACAGTGAGATGAAATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009575.1-482s1c1
Sequence:CCGGCCAGATACATTCGACTATGCTCTCGAGAGCATAGTCGAATGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009575.1-1448s1c1
Sequence:CCGGGACCAGAAACTCCAAGACTTACTCGAGTAAGTCTTGGAGTTTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009575.1-1442s1c1
Sequence:CCGGGAGTTTGACCAGAAACTCCAACTCGAGTTGGAGTTTCTGGTCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009575.1-750s1c1
Sequence:CCGGGCTGTAAATCCCGCACCTTTACTCGAGTAAAGGTGCGGGATTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks