EMAIL THIS PAGE TO A FRIEND

ARMCX6

armadillo repeat containing, X-linked 6

118 Gene Product Result for
UniProtKB ID: Q7L4S7, Q9NWJ3
Gene ID:
Mouse(278097) armadillo repeat containing, X-linked 6
Rat(363496) armadillo repeat containing, X-linked 6
dog(100687647) armadillo repeat containing, X-linked 6
domestic cat(101092421) armadillo repeat containing, X-linked 6
cow(768308) armadillo repeat containing, X-linked 6
sheep(101106998) armadillo repeat containing, X-linked 6
domestic guinea pig(100727224) armadillo repeat containing, X-linked 6
naked mole-rat(101711055) armadillo repeat containing, X-linked 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019007 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019007 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019007 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001007578 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001007578 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001007578 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009584 Rosetta Predictions human pricing
NM_019007 Rosetta Predictions human pricing
NM_001007757 Rosetta Predictions rat pricing
NM_001007578 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009584 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129567 predicted 825
2 SASI_Hs01_00129568 predicted 839
3 SASI_Hs01_00129570 predicted 968
4 SASI_Hs01_00129571 predicted 703
5 SASI_Hs02_00305644 predicted 697
6 SASI_Hs02_00305645 predicted 1070
7 SASI_Hs01_00129572 predicted 1243
8 SASI_Hs02_00305646 predicted 725
9 SASI_Hs02_00305647 predicted 966
10 SASI_Hs01_00129573 predicted 817
11 SASI_Hs01_00129566 predicted 986
12 SASI_Hs01_00129569 predicted 1289
13 SASI_Hs01_00129574 predicted 715
14 SASI_Hs01_00129575 predicted 1163
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019007 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134780 predicted 901
2 SASI_Hs01_00134781 predicted 916
3 SASI_Hs01_00134783 predicted 1056
4 SASI_Hs01_00134784 predicted 782
5 SASI_Hs02_00352531 predicted 781
6 SASI_Hs02_00352532 predicted 1150
7 SASI_Hs01_00134785 predicted 1326
8 SASI_Hs02_00352533 predicted 806
9 SASI_Hs02_00352534 predicted 1047
10 SASI_Hs01_00134786 predicted 904
11 SASI_Hs01_00134779 predicted 1071
12 SASI_Hs01_00134782 predicted 1371
13 SASI_Hs01_00134787 predicted 799
14 SASI_Hs01_00134788 predicted 1240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007757 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099737 predicted 1118
2 SASI_Rn01_00099738 predicted 1290
3 SASI_Rn01_00099739 predicted 403
4 SASI_Rn01_00099740 predicted 1172
5 SASI_Rn01_00099741 predicted 795
6 SASI_Rn01_00099742 predicted 511
7 SASI_Rn01_00099743 predicted 1012
8 SASI_Rn01_00099744 predicted 998
9 SASI_Rn01_00099745 predicted 896
10 SASI_Rn02_00198953 predicted 1194
11 SASI_Rn01_00099746 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007578 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034864 predicted 566
2 SASI_Mm01_00034865 predicted 1352
3 SASI_Mm01_00034866 predicted 1224
4 SASI_Mm01_00034867 predicted 460
5 SASI_Mm01_00034868 predicted 744
6 SASI_Mm01_00034869 predicted 1065
7 SASI_Mm01_00034870 predicted 1047
8 SASI_Mm01_00034871 predicted 1381
9 SASI_Mm02_00286759 predicted 780
10 SASI_Mm02_00286760 predicted 673
11 SASI_Mm01_00034872 predicted 1183
12 SASI_Mm01_00034873 predicted 950
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019007
VALIDATED
ARMCX6 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing, X-linked 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019007.2-1203s1c1
Sequence:CCGGCAGAAATGGAAACAGAGAGATCTCGAGATCTCTCTGTTTCCATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_019007.2-1091s1c1
Sequence:CCGGGATGTGCTAAGGTTCAGGTTTCTCGAGAAACCTGAACCTTAGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019007.2-990s1c1
Sequence:CCGGGCAGGCCGGATTAAATTTGTTCTCGAGAACAAATTTAATCCGGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019007.2-411s1c1
Sequence:CCGGCTGCGTTTACAAACTGACCATCTCGAGATGGTCAGTTTGTAAACGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_019007.2-887s1c1
Sequence:CCGGCGGATAACTTAAATGCGAGTACTCGAGTACTCGCATTTAAGTTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019007.3-1091s21c1
Sequence:CCGGGATGTGCTAAGGTTCAGGTTTCTCGAGAAACCTGAACCTTAGCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019007.3-990s21c1
Sequence:CCGGGCAGGCCGGATTAAATTTGTTCTCGAGAACAAATTTAATCCGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019007.3-627s21c1
Sequence:CCGGCAACCGAGCACACCCAATAAACTCGAGTTTATTGGGTGTGCTCGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019007.3-1203s21c1
Sequence:CCGGCAGAAATGGAAACAGAGAGATCTCGAGATCTCTCTGTTTCCATTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019007.3-500s21c1
Sequence:CCGGATGAGGAGGAGCCTGATATTTCTCGAGAAATATCAGGCTCCTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019007
VALIDATED
ARMCX6 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing, X-linked 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019007.2-1203s1c1
Sequence:CCGGCAGAAATGGAAACAGAGAGATCTCGAGATCTCTCTGTTTCCATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_019007.2-1091s1c1
Sequence:CCGGGATGTGCTAAGGTTCAGGTTTCTCGAGAAACCTGAACCTTAGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019007.2-990s1c1
Sequence:CCGGGCAGGCCGGATTAAATTTGTTCTCGAGAACAAATTTAATCCGGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019007.2-411s1c1
Sequence:CCGGCTGCGTTTACAAACTGACCATCTCGAGATGGTCAGTTTGTAAACGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_019007.2-887s1c1
Sequence:CCGGCGGATAACTTAAATGCGAGTACTCGAGTACTCGCATTTAAGTTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019007.3-1091s21c1
Sequence:CCGGGATGTGCTAAGGTTCAGGTTTCTCGAGAAACCTGAACCTTAGCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019007.3-990s21c1
Sequence:CCGGGCAGGCCGGATTAAATTTGTTCTCGAGAACAAATTTAATCCGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019007.3-627s21c1
Sequence:CCGGCAACCGAGCACACCCAATAAACTCGAGTTTATTGGGTGTGCTCGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019007.3-1203s21c1
Sequence:CCGGCAGAAATGGAAACAGAGAGATCTCGAGATCTCTCTGTTTCCATTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019007.3-500s21c1
Sequence:CCGGATGAGGAGGAGCCTGATATTTCTCGAGAAATATCAGGCTCCTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019007
VALIDATED
ARMCX6 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing, X-linked 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019007.2-1203s1c1
Sequence:CCGGCAGAAATGGAAACAGAGAGATCTCGAGATCTCTCTGTTTCCATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_019007.2-1091s1c1
Sequence:CCGGGATGTGCTAAGGTTCAGGTTTCTCGAGAAACCTGAACCTTAGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019007.2-990s1c1
Sequence:CCGGGCAGGCCGGATTAAATTTGTTCTCGAGAACAAATTTAATCCGGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019007.2-411s1c1
Sequence:CCGGCTGCGTTTACAAACTGACCATCTCGAGATGGTCAGTTTGTAAACGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_019007.2-887s1c1
Sequence:CCGGCGGATAACTTAAATGCGAGTACTCGAGTACTCGCATTTAAGTTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019007.3-1091s21c1
Sequence:CCGGGATGTGCTAAGGTTCAGGTTTCTCGAGAAACCTGAACCTTAGCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019007.3-990s21c1
Sequence:CCGGGCAGGCCGGATTAAATTTGTTCTCGAGAACAAATTTAATCCGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019007.3-627s21c1
Sequence:CCGGCAACCGAGCACACCCAATAAACTCGAGTTTATTGGGTGTGCTCGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019007.3-1203s21c1
Sequence:CCGGCAGAAATGGAAACAGAGAGATCTCGAGATCTCTCTGTTTCCATTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019007.3-500s21c1
Sequence:CCGGATGAGGAGGAGCCTGATATTTCTCGAGAAATATCAGGCTCCTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007578
ARMCX6 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing, X-linked 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007578.1-1525s1c1
Sequence:CCGGGCAGGTAAAGTGCATTGTAAACTCGAGTTTACAATGCACTTTACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007578.1-710s1c1
Sequence:CCGGGCCATTCCCTTATGAACATAACTCGAGTTATGTTCATAAGGGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007578.1-748s1c1
Sequence:CCGGAGAGCTTTAAATCCTTCACTTCTCGAGAAGTGAAGGATTTAAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007578.1-1053s1c1
Sequence:CCGGGCAGGATTAAGTCTGCTAATACTCGAGTATTAGCAGACTTAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007578.1-981s1c1
Sequence:CCGGCAGATTAAGATGTCCATTGATCTCGAGATCAATGGACATCTTAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007578
ARMCX6 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing, X-linked 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007578.1-1525s1c1
Sequence:CCGGGCAGGTAAAGTGCATTGTAAACTCGAGTTTACAATGCACTTTACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007578.1-710s1c1
Sequence:CCGGGCCATTCCCTTATGAACATAACTCGAGTTATGTTCATAAGGGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007578.1-748s1c1
Sequence:CCGGAGAGCTTTAAATCCTTCACTTCTCGAGAAGTGAAGGATTTAAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007578.1-1053s1c1
Sequence:CCGGGCAGGATTAAGTCTGCTAATACTCGAGTATTAGCAGACTTAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007578.1-981s1c1
Sequence:CCGGCAGATTAAGATGTCCATTGATCTCGAGATCAATGGACATCTTAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007578
ARMCX6 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing, X-linked 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007578.1-1525s1c1
Sequence:CCGGGCAGGTAAAGTGCATTGTAAACTCGAGTTTACAATGCACTTTACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007578.1-710s1c1
Sequence:CCGGGCCATTCCCTTATGAACATAACTCGAGTTATGTTCATAAGGGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007578.1-748s1c1
Sequence:CCGGAGAGCTTTAAATCCTTCACTTCTCGAGAAGTGAAGGATTTAAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007578.1-1053s1c1
Sequence:CCGGGCAGGATTAAGTCTGCTAATACTCGAGTATTAGCAGACTTAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007578.1-981s1c1
Sequence:CCGGCAGATTAAGATGTCCATTGATCTCGAGATCAATGGACATCTTAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks