EMAIL THIS PAGE TO A FRIEND

ARMS2

age-related maculopathy susceptibility 2

17 Gene Product Result for
Synonyms: ARMD8
Species: Human ARMS2(387715)
UniProtKB ID: P0C7Q2, B2Y7I5
Gene ID:
Human(387715) Summary: This gene encodes a protein that is thought to play a role in diseases in the elderly. Mutations in this gene have been associated with age-related macular degeneration. [provided by RefSeq, Oct 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA067225 Anti-ARMS2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099667 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099667 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099667 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099667 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320946 predicted 751
2 SASI_Hs02_00320947 predicted 668
3 SASI_Hs02_00320948 predicted 211
4 SASI_Hs02_00320949 predicted 741
5 SASI_Hs02_00320950 predicted 229
6 SASI_Hs02_00320951 predicted 281
7 SASI_Hs02_00320952 predicted 676
8 SASI_Hs02_00320953 predicted 272
9 SASI_Hs02_00320954 predicted 590
10 SASI_Hs02_00320955 predicted 670
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099667
ARMS2 MISSION shRNA Bacterial Glycerol Stock
age-related maculopathy susceptibility 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099667.1-625s21c1
Sequence:CCGGGCTCTGTGCAGCTGGTGAAATCTCGAGATTTCACCAGCTGCACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099667.1-255s21c1
Sequence:CCGGTCCATGATCCCAGCTGCTAAACTCGAGTTTAGCAGCTGGGATCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099667.1-148s21c1
Sequence:CCGGTGGTTCCTGTGTCCTTCATTTCTCGAGAAATGAAGGACACAGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099667.1-228s21c1
Sequence:CCGGCAGAGGAGCAAACTGTCTTTACTCGAGTAAAGACAGTTTGCTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099667.1-372s21c1
Sequence:CCGGCACACTGCAGCAAGGTGATTCCTCGAGGAATCACCTTGCTGCAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099667
ARMS2 MISSION shRNA shRNA Plasmid DNA
age-related maculopathy susceptibility 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099667.1-625s21c1
Sequence:CCGGGCTCTGTGCAGCTGGTGAAATCTCGAGATTTCACCAGCTGCACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099667.1-255s21c1
Sequence:CCGGTCCATGATCCCAGCTGCTAAACTCGAGTTTAGCAGCTGGGATCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099667.1-148s21c1
Sequence:CCGGTGGTTCCTGTGTCCTTCATTTCTCGAGAAATGAAGGACACAGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099667.1-228s21c1
Sequence:CCGGCAGAGGAGCAAACTGTCTTTACTCGAGTAAAGACAGTTTGCTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099667.1-372s21c1
Sequence:CCGGCACACTGCAGCAAGGTGATTCCTCGAGGAATCACCTTGCTGCAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099667
ARMS2 MISSION shRNA Lentiviral Transduction Particles
age-related maculopathy susceptibility 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099667.1-625s21c1
Sequence:CCGGGCTCTGTGCAGCTGGTGAAATCTCGAGATTTCACCAGCTGCACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099667.1-255s21c1
Sequence:CCGGTCCATGATCCCAGCTGCTAAACTCGAGTTTAGCAGCTGGGATCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099667.1-148s21c1
Sequence:CCGGTGGTTCCTGTGTCCTTCATTTCTCGAGAAATGAAGGACACAGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099667.1-228s21c1
Sequence:CCGGCAGAGGAGCAAACTGTCTTTACTCGAGTAAAGACAGTTTGCTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099667.1-372s21c1
Sequence:CCGGCACACTGCAGCAAGGTGATTCCTCGAGGAATCACCTTGCTGCAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks