EMAIL THIS PAGE TO A FRIEND

ARNT2

aryl-hydrocarbon receptor nuclear translocator 2

68 Gene Product Result for
Synonyms: bHLHe1
UniProtKB ID: Q9HBZ2, B4DIS7, O15024, Q8IYC2
Gene ID:
Human(9915) Summary: This gene encodes a member of the basic-helix-loop-helix-Per-Arnt-Sim (bHLH-PAS) superfamily of transcription factors. The encoded protein acts as a partner for several sensor proteins of the bHLH-PAS family, forming heterodimers with the sensor proteins that bind regulatory DNA sequences in genes responsive to developmental and environmental stimuli. Under hypoxic conditions, the encoded protein complexes with hypoxia-inducible factor 1alpha in the nucleus and this complex binds to hypoxia-responsive elements in enhancers and promoters of oxygen-responsive genes. A highly similar protein in mouse forms functional complexes with both aryl hydrocarbon receptors and Single-minded proteins, suggesting addition roles for the encoded protein in the metabolism of xenobiotic compounds and the regulation of neurogenesis, respectively. [provided by RefSeq, Jul 2008]
Mouse(11864) aryl hydrocarbon receptor nuclear translocator 2
Rat(25243) aryl hydrocarbon receptor nuclear translocator 2
sheep(100135448) aryl-hydrocarbon receptor nuclear translocator 2
domestic guinea pig(100727525) aryl-hydrocarbon receptor nuclear translocator 2
naked mole-rat(101715821) aryl-hydrocarbon receptor nuclear translocator 2
Zebrafish(64277) aryl hydrocarbon receptor nuclear translocator 2
dog(608366) aryl-hydrocarbon receptor nuclear translocator 2
domestic cat(101087746) aryl-hydrocarbon receptor nuclear translocator 2
Horse(100067423) aryl-hydrocarbon receptor nuclear translocator 2
cow(533445) aryl-hydrocarbon receptor nuclear translocator 2
chicken(415481) aryl-hydrocarbon receptor nuclear translocator 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007488 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007488 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007488 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014862 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014862 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014862 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014862 Rosetta Predictions human pricing
NM_012781 Rosetta Predictions rat pricing
NM_007488 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078252 predicted 1663
2 SASI_Hs01_00078253 predicted 1217
3 SASI_Hs01_00078254 predicted 1004
4 SASI_Hs02_00346447 predicted 1828
5 SASI_Hs01_00078255 predicted 928
6 SASI_Hs01_00078256 predicted 2256
7 SASI_Hs01_00078257 predicted 1424
8 SASI_Hs01_00078258 predicted 1943
9 SASI_Hs01_00078259 predicted 1624
10 SASI_Hs01_00078260 predicted 814
11 SASI_Hs01_00078261 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012781 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092972 predicted 2243
2 SASI_Rn01_00092973 predicted 1852
3 SASI_Rn01_00092975 predicted 376
4 SASI_Rn01_00092976 predicted 2263
5 SASI_Rn01_00092977 predicted 1367
6 SASI_Rn01_00092978 predicted 440
7 SASI_Rn01_00092979 predicted 557
8 SASI_Rn01_00092980 predicted 842
9 SASI_Rn01_00092981 predicted 960
10 SASI_Rn02_00260185 predicted 1724
11 SASI_Rn01_00092974 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007488 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029681 predicted 1468
2 SASI_Mm01_00029682 predicted 2259
3 SASI_Mm01_00029683 predicted 1709
4 SASI_Mm01_00029684 predicted 835
5 SASI_Mm01_00029685 predicted 940
6 SASI_Mm01_00029686 predicted 1338
7 SASI_Mm02_00311756 predicted 604
8 SASI_Mm01_00029687 predicted 2149
9 SASI_Mm01_00029688 predicted 948
10 SASI_Mm01_00029689 predicted 1280
11 SASI_Mm01_00029680 predicted 1748
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007488
VALIDATED
ARNT2 MISSION shRNA Bacterial Glycerol Stock
aryl-hydrocarbon receptor nuclear translocator 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007488.2-1342s1c1
Sequence:CCGGCCTACTCTGATGAGATCGAGTCTCGAGACTCGATCTCATCAGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007488.2-2246s1c1
Sequence:CCGGCGCTATTATCATGCCATAGATCTCGAGATCTATGGCATGATAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007488.2-821s1c1
Sequence:CCGGCCACCTGCCTTTGAACAGAATCTCGAGATTCTGTTCAAAGGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007488.2-240s1c1
Sequence:CCGGGATGGTGAAGGTCCCAGTAAACTCGAGTTTACTGGGACCTTCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007488.2-1855s1c1
Sequence:CCGGGAATTGGATCAAGCCACCCTTCTCGAGAAGGGTGGCTTGATCCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007488.2-240s21c1
Sequence:CCGGGATGGTGAAGGTCCCAGTAAACTCGAGTTTACTGGGACCTTCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323726    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007488.2-2246s21c1
Sequence:CCGGCGCTATTATCATGCCATAGATCTCGAGATCTATGGCATGATAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007488.2-980s21c1
Sequence:CCGGTGTCGGACAAGGCAGTAAATACTCGAGTATTTACTGCCTTGTCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007488.2-1342s21c1
Sequence:CCGGCCTACTCTGATGAGATCGAGTCTCGAGACTCGATCTCATCAGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007488.2-821s21c1
Sequence:CCGGCCACCTGCCTTTGAACAGAATCTCGAGATTCTGTTCAAAGGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007488
VALIDATED
ARNT2 MISSION shRNA shRNA Plasmid DNA
aryl-hydrocarbon receptor nuclear translocator 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007488.2-1342s1c1
Sequence:CCGGCCTACTCTGATGAGATCGAGTCTCGAGACTCGATCTCATCAGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007488.2-2246s1c1
Sequence:CCGGCGCTATTATCATGCCATAGATCTCGAGATCTATGGCATGATAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007488.2-821s1c1
Sequence:CCGGCCACCTGCCTTTGAACAGAATCTCGAGATTCTGTTCAAAGGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007488.2-240s1c1
Sequence:CCGGGATGGTGAAGGTCCCAGTAAACTCGAGTTTACTGGGACCTTCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007488.2-1855s1c1
Sequence:CCGGGAATTGGATCAAGCCACCCTTCTCGAGAAGGGTGGCTTGATCCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007488.2-240s21c1
Sequence:CCGGGATGGTGAAGGTCCCAGTAAACTCGAGTTTACTGGGACCTTCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323726    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007488.2-2246s21c1
Sequence:CCGGCGCTATTATCATGCCATAGATCTCGAGATCTATGGCATGATAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007488.2-980s21c1
Sequence:CCGGTGTCGGACAAGGCAGTAAATACTCGAGTATTTACTGCCTTGTCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007488.2-1342s21c1
Sequence:CCGGCCTACTCTGATGAGATCGAGTCTCGAGACTCGATCTCATCAGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007488.2-821s21c1
Sequence:CCGGCCACCTGCCTTTGAACAGAATCTCGAGATTCTGTTCAAAGGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007488
VALIDATED
ARNT2 MISSION shRNA Lentiviral Transduction Particles
aryl-hydrocarbon receptor nuclear translocator 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007488.2-1342s1c1
Sequence:CCGGCCTACTCTGATGAGATCGAGTCTCGAGACTCGATCTCATCAGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007488.2-2246s1c1
Sequence:CCGGCGCTATTATCATGCCATAGATCTCGAGATCTATGGCATGATAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007488.2-821s1c1
Sequence:CCGGCCACCTGCCTTTGAACAGAATCTCGAGATTCTGTTCAAAGGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007488.2-240s1c1
Sequence:CCGGGATGGTGAAGGTCCCAGTAAACTCGAGTTTACTGGGACCTTCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007488.2-1855s1c1
Sequence:CCGGGAATTGGATCAAGCCACCCTTCTCGAGAAGGGTGGCTTGATCCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007488.2-240s21c1
Sequence:CCGGGATGGTGAAGGTCCCAGTAAACTCGAGTTTACTGGGACCTTCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323726    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007488.2-2246s21c1
Sequence:CCGGCGCTATTATCATGCCATAGATCTCGAGATCTATGGCATGATAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007488.2-980s21c1
Sequence:CCGGTGTCGGACAAGGCAGTAAATACTCGAGTATTTACTGCCTTGTCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007488.2-1342s21c1
Sequence:CCGGCCTACTCTGATGAGATCGAGTCTCGAGACTCGATCTCATCAGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007488.2-821s21c1
Sequence:CCGGCCACCTGCCTTTGAACAGAATCTCGAGATTCTGTTCAAAGGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014862
VALIDATED
ARNT2 MISSION shRNA Bacterial Glycerol Stock
aryl-hydrocarbon receptor nuclear translocator 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014862.2-1503s1c1
Sequence:CCGGCCTCGGTTTGCTGAAATGTTTCTCGAGAAACATTTCAGCAAACCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014862.2-1666s1c1
Sequence:CCGGTGAATGATATTCAGTCCTCTTCTCGAGAAGAGGACTGAATATCATTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014862.2-1030s1c1
Sequence:CCGGCAGAGTTCTTATCCCGGCATACTCGAGTATGCCGGGATAAGAACTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014862.2-217s1c1
Sequence:CCGGCAAGAGAGAATCATAGTGAAACTCGAGTTTCACTATGATTCTCTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014862.2-438s1c1
Sequence:CCGGCTGAAGCATCTCATCCTTGAACTCGAGTTCAAGGATGAGATGCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014862.3-1072s21c1
Sequence:CCGGTGTGGGACAAGGCAGTAAATACTCGAGTATTTACTGCCTTGTCCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014862.3-1356s21c1
Sequence:CCGGTGTCGGTCATGTATCGATTTCCTCGAGGAAATCGATACATGACCGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014862
VALIDATED
ARNT2 MISSION shRNA shRNA Plasmid DNA
aryl-hydrocarbon receptor nuclear translocator 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014862.2-1503s1c1
Sequence:CCGGCCTCGGTTTGCTGAAATGTTTCTCGAGAAACATTTCAGCAAACCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014862.2-1666s1c1
Sequence:CCGGTGAATGATATTCAGTCCTCTTCTCGAGAAGAGGACTGAATATCATTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014862.2-1030s1c1
Sequence:CCGGCAGAGTTCTTATCCCGGCATACTCGAGTATGCCGGGATAAGAACTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014862.2-217s1c1
Sequence:CCGGCAAGAGAGAATCATAGTGAAACTCGAGTTTCACTATGATTCTCTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014862.2-438s1c1
Sequence:CCGGCTGAAGCATCTCATCCTTGAACTCGAGTTCAAGGATGAGATGCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014862.3-1072s21c1
Sequence:CCGGTGTGGGACAAGGCAGTAAATACTCGAGTATTTACTGCCTTGTCCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014862.3-1356s21c1
Sequence:CCGGTGTCGGTCATGTATCGATTTCCTCGAGGAAATCGATACATGACCGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014862
VALIDATED
ARNT2 MISSION shRNA Lentiviral Transduction Particles
aryl-hydrocarbon receptor nuclear translocator 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014862.2-1503s1c1
Sequence:CCGGCCTCGGTTTGCTGAAATGTTTCTCGAGAAACATTTCAGCAAACCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014862.2-1666s1c1
Sequence:CCGGTGAATGATATTCAGTCCTCTTCTCGAGAAGAGGACTGAATATCATTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014862.2-1030s1c1
Sequence:CCGGCAGAGTTCTTATCCCGGCATACTCGAGTATGCCGGGATAAGAACTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014862.2-217s1c1
Sequence:CCGGCAAGAGAGAATCATAGTGAAACTCGAGTTTCACTATGATTCTCTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014862.2-438s1c1
Sequence:CCGGCTGAAGCATCTCATCCTTGAACTCGAGTTCAAGGATGAGATGCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014862.3-1072s21c1
Sequence:CCGGTGTGGGACAAGGCAGTAAATACTCGAGTATTTACTGCCTTGTCCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014862.3-1356s21c1
Sequence:CCGGTGTCGGTCATGTATCGATTTCCTCGAGGAAATCGATACATGACCGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks