EMAIL THIS PAGE TO A FRIEND

ARNT

aryl hydrocarbon receptor nuclear translocator

86 Gene Product Result for
Synonyms: HIF-1-beta HIF-1beta HIF1-beta HIF1B HIF1BETA TANGO bHLHe2
UniProtKB ID: P27540, C4AMA1, Q5QP39, Q8NDC7
Gene ID:
Human(405) Summary: The aryl hydrocarbon (Ah) receptor is involved in the induction of several enzymes that participate in xenobiotic metabolism. The ligand-free, cytosolic form of the Ah receptor is complexed to heat shock protein 90. Binding of ligand, which includes dioxin and polycyclic aromatic hydrocarbons, results in translocation of the ligand-binding subunit only to the nucleus. Induction of enzymes involved in xenobiotic metabolism occurs through binding of the ligand-bound Ah receptor to xenobiotic responsive elements in the promoters of genes for these enzymes. This gene encodes a protein that forms a complex with the ligand-bound Ah receptor, and is required for receptor function. The encoded protein has also been identified as the beta subunit of a heterodimeric transcription factor, hypoxia-inducible factor 1. A t(1;12)(q21;p13) translocation, which results in a TEL-ARNT fusion protein, is associated with acute myeloblastic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
Mouse(11863) aryl hydrocarbon receptor nuclear translocator
Rat(25242) aryl hydrocarbon receptor nuclear translocator
Zebrafish(493634) aryl hydrocarbon receptor nuclear translocator
cow(281010) aryl hydrocarbon receptor nuclear translocator
domestic cat(101093627) aryl hydrocarbon receptor nuclear translocator
dog(483185) aryl hydrocarbon receptor nuclear translocator
chicken(374026) aryl hydrocarbon receptor nuclear translocator
naked mole-rat(101717560) aryl hydrocarbon receptor nuclear translocator
domestic guinea pig(100379223) aryl hydrocarbon receptor nuclear translocator
sheep(443285) aryl hydrocarbon receptor nuclear translocator
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001668 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001668 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001668 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009709 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009709 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009709 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001668 Rosetta Predictions human pricing
NM_178426 Rosetta Predictions human pricing
NM_178427 Rosetta Predictions human pricing
NM_012780 Rosetta Predictions rat pricing
NM_001037737 Rosetta Predictions mouse pricing
NM_009709 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001668 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166998 predicted 2659
2 SASI_Hs01_00166999 predicted 2782
3 SASI_Hs01_00167000 predicted 650
4 SASI_Hs01_00167001 predicted 735
5 SASI_Hs01_00167002 predicted 711
6 SASI_Hs01_00167003 predicted 2812
7 SASI_Hs01_00167004 predicted 839
8 SASI_Hs02_00332301 predicted 849
9 SASI_Hs01_00167005 predicted 2776
10 SASI_Hs01_00167006 predicted 2662
11 SASI_Hs01_00167007 predicted 2789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132454 predicted 1377
2 SASI_Hs01_00132455 predicted 1495
3 SASI_Hs01_00132456 predicted 652
4 SASI_Hs01_00132457 predicted 740
5 SASI_Hs01_00132458 predicted 710
6 SASI_Hs01_00132459 predicted 1520
7 SASI_Hs01_00132460 predicted 843
8 SASI_Hs02_00369660 predicted 850
9 SASI_Hs01_00132461 predicted 1488
10 SASI_Hs01_00132462 predicted 1381
11 SASI_Hs01_00132463 predicted 1501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178427 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225005 predicted 2612
2 SASI_Hs01_00225006 predicted 2738
3 SASI_Hs01_00225007 predicted 607
4 SASI_Hs01_00225008 predicted 694
5 SASI_Hs01_00225009 predicted 658
6 SASI_Hs01_00225010 predicted 2759
7 SASI_Hs01_00225011 predicted 800
8 SASI_Hs02_00369661 predicted 807
9 SASI_Hs01_00225012 predicted 2730
10 SASI_Hs01_00225013 predicted 2620
11 SASI_Hs01_00225014 predicted 2740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012780 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055819 predicted 834
2 SASI_Rn01_00055820 predicted 384
3 SASI_Rn01_00055821 predicted 319
4 SASI_Rn01_00055822 predicted 1215
5 SASI_Rn01_00055823 predicted 2021
6 SASI_Rn01_00055824 predicted 1897
7 SASI_Rn01_00055826 predicted 1081
8 SASI_Rn01_00055827 predicted 1044
9 SASI_Rn01_00055828 predicted 1174
10 SASI_Rn02_00260184 predicted 1031
11 SASI_Rn01_00055825 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037737 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289386 predicted 965
2 SASI_Mm01_00041994 predicted 2155
3 SASI_Mm01_00041995 predicted 789
4 SASI_Mm01_00041996 predicted 2135
5 SASI_Mm02_00289387 predicted 1357
6 SASI_Mm01_00041998 predicted 1170
7 SASI_Mm01_00041999 predicted 2481
8 SASI_Mm01_00042000 predicted 1604
9 SASI_Mm01_00042001 predicted 2354
10 SASI_Mm01_00042002 predicted 1605
11 SASI_Mm01_00041993 predicted 1459
12 SASI_Mm01_00041997 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009709 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316855 predicted 920
2 SASI_Mm01_00155778 predicted 2110
3 SASI_Mm01_00155779 predicted 739
4 SASI_Mm01_00155780 predicted 2087
5 SASI_Mm02_00316856 predicted 1317
6 SASI_Mm01_00155782 predicted 1130
7 SASI_Mm01_00155783 predicted 2433
8 SASI_Mm01_00155784 predicted 1560
9 SASI_Mm01_00155785 predicted 2307
10 SASI_Mm01_00155786 predicted 1559
11 SASI_Mm01_00155777 predicted 1398
12 SASI_Mm01_00155781 predicted 1224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001668
VALIDATED
ARNT MISSION shRNA Bacterial Glycerol Stock
aryl hydrocarbon receptor nuclear translocator
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001668.2-842s21c1
Sequence:CCGGAGGGCGTATCCTGGATCTAAACTCGAGTTTAGATCCAGGATACGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001668.2-1592s21c1
Sequence:CCGGACTAGGTCCCACAGCTAATTTCTCGAGAAATTAGCTGTGGGACCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001668.2-915s21c1
Sequence:CCGGGGCTCAAGGAGATCGTTTATTCTCGAGAATAAACGATCTCCTTGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_001668.x-2341s1c1
Sequence:CCGGAGCCTCATCATCGTTCAAGTTCTCGAGAACTTGAACGATGATGAGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001668.x-248s1c1
Sequence:CCGGCATTGTCCAGAGGGCTATTAACTCGAGTTAATAGCCCTCTGGACAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001668.x-1770s1c1
Sequence:CCGGGAGAAGTCAGATGGTTTATTTCTCGAGAAATAAACCATCTGACTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003817    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_001668.x-3146s1c1
Sequence:CCGGCCTTTGTCTTTCTGTGTACTTCTCGAGAAGTACACAGAAAGACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_001668.x-1559s1c1
Sequence:CCGGGCCTACACTCTCCAACACAATCTCGAGATTGTGTTGGAGAGTGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001668
VALIDATED
ARNT MISSION shRNA shRNA Plasmid DNA
aryl hydrocarbon receptor nuclear translocator
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001668.2-842s21c1
Sequence:CCGGAGGGCGTATCCTGGATCTAAACTCGAGTTTAGATCCAGGATACGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001668.2-1592s21c1
Sequence:CCGGACTAGGTCCCACAGCTAATTTCTCGAGAAATTAGCTGTGGGACCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001668.2-915s21c1
Sequence:CCGGGGCTCAAGGAGATCGTTTATTCTCGAGAATAAACGATCTCCTTGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_001668.x-2341s1c1
Sequence:CCGGAGCCTCATCATCGTTCAAGTTCTCGAGAACTTGAACGATGATGAGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001668.x-248s1c1
Sequence:CCGGCATTGTCCAGAGGGCTATTAACTCGAGTTAATAGCCCTCTGGACAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001668.x-1770s1c1
Sequence:CCGGGAGAAGTCAGATGGTTTATTTCTCGAGAAATAAACCATCTGACTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003817    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_001668.x-3146s1c1
Sequence:CCGGCCTTTGTCTTTCTGTGTACTTCTCGAGAAGTACACAGAAAGACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_001668.x-1559s1c1
Sequence:CCGGGCCTACACTCTCCAACACAATCTCGAGATTGTGTTGGAGAGTGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001668
VALIDATED
ARNT MISSION shRNA Lentiviral Transduction Particles
aryl hydrocarbon receptor nuclear translocator
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001668.2-842s21c1
Sequence:CCGGAGGGCGTATCCTGGATCTAAACTCGAGTTTAGATCCAGGATACGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001668.2-1592s21c1
Sequence:CCGGACTAGGTCCCACAGCTAATTTCTCGAGAAATTAGCTGTGGGACCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001668.2-915s21c1
Sequence:CCGGGGCTCAAGGAGATCGTTTATTCTCGAGAATAAACGATCTCCTTGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_001668.x-2341s1c1
Sequence:CCGGAGCCTCATCATCGTTCAAGTTCTCGAGAACTTGAACGATGATGAGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001668.x-248s1c1
Sequence:CCGGCATTGTCCAGAGGGCTATTAACTCGAGTTAATAGCCCTCTGGACAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001668.x-1770s1c1
Sequence:CCGGGAGAAGTCAGATGGTTTATTTCTCGAGAAATAAACCATCTGACTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003817    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_001668.x-3146s1c1
Sequence:CCGGCCTTTGTCTTTCTGTGTACTTCTCGAGAAGTACACAGAAAGACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_001668.x-1559s1c1
Sequence:CCGGGCCTACACTCTCCAACACAATCTCGAGATTGTGTTGGAGAGTGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009709
VALIDATED
ARNT MISSION shRNA Bacterial Glycerol Stock
aryl hydrocarbon receptor nuclear translocator
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009709.4-252s21c1
Sequence:CCGGTGTTGTACAGAGGGCTATTAACTCGAGTTAATAGCCCTCTGTACAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009709.4-2771s21c1
Sequence:CCGGAGAATCTGACAGGCACTAATTCTCGAGAATTAGTGCCTGTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009709.4-1389s21c1
Sequence:CCGGCCGATCTAAGACCCGAGAATGCTCGAGCATTCTCGGGTCTTAGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009709.4-1553s21c1
Sequence:CCGGTAGGTCCGACAGCCAATTTATCTCGAGATAAATTGGCTGTCGGACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009709.1-2340s1c1
Sequence:CCGGTGGGGGGAAATCACTGTTTGTCTCGAGACAAACAGTGATTTCCCCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009709.1-1919s1c1
Sequence:CCGGCCAAGACTCGTTCTTCCCAATCTCGAGATTGGGAAGAACGAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009709.1-1769s1c1
Sequence:CCGGCTGTAACCATTGTCCAGCCATCTCGAGATGGCTGGACAATGGTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009709.1-1035s1c1
Sequence:CCGGCCGACACAACATTGAAGGGATCTCGAGATCCCTTCAATGTTGTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009709.1-316s1c1
Sequence:CCGGCCAGACAAGCTAACCATCTTACTCGAGTAAGATGGTTAGCTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009709
VALIDATED
ARNT MISSION shRNA shRNA Plasmid DNA
aryl hydrocarbon receptor nuclear translocator
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009709.4-252s21c1
Sequence:CCGGTGTTGTACAGAGGGCTATTAACTCGAGTTAATAGCCCTCTGTACAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009709.4-2771s21c1
Sequence:CCGGAGAATCTGACAGGCACTAATTCTCGAGAATTAGTGCCTGTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009709.4-1389s21c1
Sequence:CCGGCCGATCTAAGACCCGAGAATGCTCGAGCATTCTCGGGTCTTAGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009709.4-1553s21c1
Sequence:CCGGTAGGTCCGACAGCCAATTTATCTCGAGATAAATTGGCTGTCGGACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009709.1-2340s1c1
Sequence:CCGGTGGGGGGAAATCACTGTTTGTCTCGAGACAAACAGTGATTTCCCCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009709.1-1919s1c1
Sequence:CCGGCCAAGACTCGTTCTTCCCAATCTCGAGATTGGGAAGAACGAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009709.1-1769s1c1
Sequence:CCGGCTGTAACCATTGTCCAGCCATCTCGAGATGGCTGGACAATGGTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009709.1-1035s1c1
Sequence:CCGGCCGACACAACATTGAAGGGATCTCGAGATCCCTTCAATGTTGTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009709.1-316s1c1
Sequence:CCGGCCAGACAAGCTAACCATCTTACTCGAGTAAGATGGTTAGCTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009709
VALIDATED
ARNT MISSION shRNA Lentiviral Transduction Particles
aryl hydrocarbon receptor nuclear translocator
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009709.4-252s21c1
Sequence:CCGGTGTTGTACAGAGGGCTATTAACTCGAGTTAATAGCCCTCTGTACAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009709.4-2771s21c1
Sequence:CCGGAGAATCTGACAGGCACTAATTCTCGAGAATTAGTGCCTGTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009709.4-1389s21c1
Sequence:CCGGCCGATCTAAGACCCGAGAATGCTCGAGCATTCTCGGGTCTTAGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009709.4-1553s21c1
Sequence:CCGGTAGGTCCGACAGCCAATTTATCTCGAGATAAATTGGCTGTCGGACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009709.1-2340s1c1
Sequence:CCGGTGGGGGGAAATCACTGTTTGTCTCGAGACAAACAGTGATTTCCCCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009709.1-1919s1c1
Sequence:CCGGCCAAGACTCGTTCTTCCCAATCTCGAGATTGGGAAGAACGAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009709.1-1769s1c1
Sequence:CCGGCTGTAACCATTGTCCAGCCATCTCGAGATGGCTGGACAATGGTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009709.1-1035s1c1
Sequence:CCGGCCGACACAACATTGAAGGGATCTCGAGATCCCTTCAATGTTGTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009709.1-316s1c1
Sequence:CCGGCCAGACAAGCTAACCATCTTACTCGAGTAAGATGGTTAGCTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks