EMAIL THIS PAGE TO A FRIEND

ARNTL2

aryl hydrocarbon receptor nuclear translocator-like 2

50 Gene Product Result for
Synonyms: BMAL2 CLIF MOP9 PASD9 bHLHe6
Gene ID:
Human(56938) Summary: This gene encodes a basic helix-loop-helix transcription factor belonging to the PAS (PER, ARNT, SIM) superfamily. The PAS proteins play important roles in adaptation to low atmospheric and cellular oxygen levels, exposure to certain environmental pollutants, and diurnal oscillations in light and temperature. This protein forms a transcriptionally active heterodimer with the circadian CLOCK protein, the structurally related MOP4, and hypoxia-inducible factors, such as HIF1alpha. Consistent with its role as a biologically relevant partner of circadian and hypoxia factors, this protein is coexpressed in regions of the brain such as the thalamus, hypothalamus, and amygdala. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Mouse(272322) aryl hydrocarbon receptor nuclear translocator-like 2
Rat(362464) aryl hydrocarbon receptor nuclear translocator-like 2
Zebrafish(58099) aryl hydrocarbon receptor nuclear translocator-like 2
chicken(373925) aryl hydrocarbon receptor nuclear translocator-like 2
domestic cat(101084294) aryl hydrocarbon receptor nuclear translocator-like 2
cow(535794) aryl hydrocarbon receptor nuclear translocator-like 2
Horse(100069111) aryl hydrocarbon receptor nuclear translocator-like 2
dog(486624) aryl hydrocarbon receptor nuclear translocator-like 2
sheep(101112046) aryl hydrocarbon receptor nuclear translocator-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172309 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172309 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172309 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020183 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020183 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020183 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071401 MISSION® esiRNA esiRNA human ARNTL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020183 Rosetta Predictions human pricing
XM_342787 Rosetta Predictions rat pricing
NM_172309 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020183 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143594 predicted 1114
2 SASI_Hs02_00353099 predicted 1395
3 SASI_Hs01_00143596 predicted 1463
4 SASI_Hs01_00143597 predicted 1626
5 SASI_Hs01_00143598 predicted 1365
6 SASI_Hs01_00143599 predicted 1508
7 SASI_Hs01_00143600 predicted 589
8 SASI_Hs02_00353100 predicted 1592
9 SASI_Hs01_00143602 predicted 1262
10 SASI_Hs01_00143603 predicted 1188
11 SASI_Hs01_00143595 predicted 439
12 SASI_Hs01_00143601 predicted 247
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342787 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394801 predicted 711
2 SASI_Rn02_00394802 predicted 879
3 SASI_Rn02_00394803 predicted 929
4 SASI_Rn02_00394804 predicted 856
5 SASI_Rn02_00394805 predicted 588
6 SASI_Rn02_00394806 predicted 426
7 SASI_Rn02_00394807 predicted 619
8 SASI_Rn02_00394808 predicted 445
9 SASI_Rn02_00394809 predicted 256
10 SASI_Rn02_00394810 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172309 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146181 predicted 1109
2 SASI_Mm01_00146182 predicted 340
3 SASI_Mm01_00146183 predicted 538
4 SASI_Mm01_00146185 predicted 634
5 SASI_Mm01_00146186 predicted 993
6 SASI_Mm01_00146187 predicted 1374
7 SASI_Mm01_00146188 predicted 198
8 SASI_Mm02_00343814 predicted 1171
9 SASI_Mm01_00146190 predicted 937
10 SASI_Mm02_00343815 predicted 950
11 SASI_Mm01_00146184 predicted 1211
12 SASI_Mm01_00146189 predicted 1065
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172309
ARNTL2 MISSION shRNA Bacterial Glycerol Stock
aryl hydrocarbon receptor nuclear translocator-like 2
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172309.1-1053s1c1
Sequence:CCGGCCACAGTAGTTTGACTGACAACTCGAGTTGTCAGTCAAACTACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172309.1-178s1c1
Sequence:CCGGCGGAGAGACAAGATGAACCATCTCGAGATGGTTCATCTTGTCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172309.1-756s1c1
Sequence:CCGGCGTCCATTGCACTGGATACTTCTCGAGAAGTATCCAGTGCAATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172309.1-1292s1c1
Sequence:CCGGCCGAAGACTCATTTAGACAATCTCGAGATTGTCTAAATGAGTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172309.1-650s1c1
Sequence:CCGGCCAGACGATCTTTCTTCTTTACTCGAGTAAAGAAGAAAGATCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-914s21c1
Sequence:CCGGTGAGACCGGCTGAGTTCATAACTCGAGTTATGAACTCAGCCGGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-1317s21c1
Sequence:CCGGCATCAATGTGCCCGGTGTATCCTCGAGGATACACCGGGCACATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-938s21c1
Sequence:CCGGGCTTCGCAATGAACGGGAAATCTCGAGATTTCCCGTTCATTGCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-566s21c1
Sequence:CCGGCACCAAGAGAGAAACCTATAGCTCGAGCTATAGGTTTCTCTCTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-1017s21c1
Sequence:CCGGGGGAACTTCATGTTATGAATACTCGAGTATTCATAACATGAAGTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-471s21c1
Sequence:CCGGTTATGATCAGGCTAGCTTGATCTCGAGATCAAGCTAGCCTGATCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-970s21c1
Sequence:CCGGGACCAAAGGGCAACGGCAATTCTCGAGAATTGCCGTTGCCCTTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-497s21c1
Sequence:CCGGAGAATTTGTTTGACTTCTTACCTCGAGGTAAGAAGTCAAACAAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-416s21c1
Sequence:CCGGGATGCGAAAGAGGGAGAATTTCTCGAGAAATTCTCCCTCTTTCGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-1469s21c1
Sequence:CCGGTAAATGGTGGGAATGCCTATGCTCGAGCATAGGCATTCCCACCATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172309
ARNTL2 MISSION shRNA shRNA Plasmid DNA
aryl hydrocarbon receptor nuclear translocator-like 2
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172309.1-1053s1c1
Sequence:CCGGCCACAGTAGTTTGACTGACAACTCGAGTTGTCAGTCAAACTACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172309.1-178s1c1
Sequence:CCGGCGGAGAGACAAGATGAACCATCTCGAGATGGTTCATCTTGTCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172309.1-756s1c1
Sequence:CCGGCGTCCATTGCACTGGATACTTCTCGAGAAGTATCCAGTGCAATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172309.1-1292s1c1
Sequence:CCGGCCGAAGACTCATTTAGACAATCTCGAGATTGTCTAAATGAGTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172309.1-650s1c1
Sequence:CCGGCCAGACGATCTTTCTTCTTTACTCGAGTAAAGAAGAAAGATCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-914s21c1
Sequence:CCGGTGAGACCGGCTGAGTTCATAACTCGAGTTATGAACTCAGCCGGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-1317s21c1
Sequence:CCGGCATCAATGTGCCCGGTGTATCCTCGAGGATACACCGGGCACATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-938s21c1
Sequence:CCGGGCTTCGCAATGAACGGGAAATCTCGAGATTTCCCGTTCATTGCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-566s21c1
Sequence:CCGGCACCAAGAGAGAAACCTATAGCTCGAGCTATAGGTTTCTCTCTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-1017s21c1
Sequence:CCGGGGGAACTTCATGTTATGAATACTCGAGTATTCATAACATGAAGTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-471s21c1
Sequence:CCGGTTATGATCAGGCTAGCTTGATCTCGAGATCAAGCTAGCCTGATCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-970s21c1
Sequence:CCGGGACCAAAGGGCAACGGCAATTCTCGAGAATTGCCGTTGCCCTTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-497s21c1
Sequence:CCGGAGAATTTGTTTGACTTCTTACCTCGAGGTAAGAAGTCAAACAAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-416s21c1
Sequence:CCGGGATGCGAAAGAGGGAGAATTTCTCGAGAAATTCTCCCTCTTTCGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-1469s21c1
Sequence:CCGGTAAATGGTGGGAATGCCTATGCTCGAGCATAGGCATTCCCACCATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172309
ARNTL2 MISSION shRNA Lentiviral Transduction Particles
aryl hydrocarbon receptor nuclear translocator-like 2
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172309.1-1053s1c1
Sequence:CCGGCCACAGTAGTTTGACTGACAACTCGAGTTGTCAGTCAAACTACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172309.1-178s1c1
Sequence:CCGGCGGAGAGACAAGATGAACCATCTCGAGATGGTTCATCTTGTCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172309.1-756s1c1
Sequence:CCGGCGTCCATTGCACTGGATACTTCTCGAGAAGTATCCAGTGCAATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172309.1-1292s1c1
Sequence:CCGGCCGAAGACTCATTTAGACAATCTCGAGATTGTCTAAATGAGTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172309.1-650s1c1
Sequence:CCGGCCAGACGATCTTTCTTCTTTACTCGAGTAAAGAAGAAAGATCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-914s21c1
Sequence:CCGGTGAGACCGGCTGAGTTCATAACTCGAGTTATGAACTCAGCCGGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-1317s21c1
Sequence:CCGGCATCAATGTGCCCGGTGTATCCTCGAGGATACACCGGGCACATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-938s21c1
Sequence:CCGGGCTTCGCAATGAACGGGAAATCTCGAGATTTCCCGTTCATTGCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-566s21c1
Sequence:CCGGCACCAAGAGAGAAACCTATAGCTCGAGCTATAGGTTTCTCTCTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-1017s21c1
Sequence:CCGGGGGAACTTCATGTTATGAATACTCGAGTATTCATAACATGAAGTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-471s21c1
Sequence:CCGGTTATGATCAGGCTAGCTTGATCTCGAGATCAAGCTAGCCTGATCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-970s21c1
Sequence:CCGGGACCAAAGGGCAACGGCAATTCTCGAGAATTGCCGTTGCCCTTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-497s21c1
Sequence:CCGGAGAATTTGTTTGACTTCTTACCTCGAGGTAAGAAGTCAAACAAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-416s21c1
Sequence:CCGGGATGCGAAAGAGGGAGAATTTCTCGAGAAATTCTCCCTCTTTCGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172309.1-1469s21c1
Sequence:CCGGTAAATGGTGGGAATGCCTATGCTCGAGCATAGGCATTCCCACCATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020183
ARNTL2 MISSION shRNA Bacterial Glycerol Stock
aryl hydrocarbon receptor nuclear translocator-like 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020183.3-439s1c1
Sequence:CCGGGCGCGTAAACTGGACAAACTTCTCGAGAAGTTTGTCCAGTTTACGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020183.3-987s1c1
Sequence:CCGGGCCTCCAAATATTGTTGGAATCTCGAGATTCCAACAATATTTGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020183.3-1364s1c1
Sequence:CCGGGCCAATGGTTTAGTTTCACAACTCGAGTTGTGAAACTAAACCATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020183.3-1555s1c1
Sequence:CCGGGCTGGTAGTATTGGAACAGATCTCGAGATCTGTTCCAATACTACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020183.3-248s1c1
Sequence:CCGGCCCTTACCTATCTTCTTTCAACTCGAGTTGAAAGAAGATAGGTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020183.3-682s21c1
Sequence:CCGGTTGACTGGACAAAGCTTATTTCTCGAGAAATAAGCTTTGTCCAGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020183.3-868s21c1
Sequence:CCGGTGTCGGATAAAGAGTTGTAAACTCGAGTTTACAACTCTTTATCCGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020183.3-478s21c1
Sequence:CCGGGTTCAACACTTGAGATCTTTACTCGAGTAAAGATCTCAAGTGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020183
ARNTL2 MISSION shRNA shRNA Plasmid DNA
aryl hydrocarbon receptor nuclear translocator-like 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020183.3-439s1c1
Sequence:CCGGGCGCGTAAACTGGACAAACTTCTCGAGAAGTTTGTCCAGTTTACGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020183.3-987s1c1
Sequence:CCGGGCCTCCAAATATTGTTGGAATCTCGAGATTCCAACAATATTTGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020183.3-1364s1c1
Sequence:CCGGGCCAATGGTTTAGTTTCACAACTCGAGTTGTGAAACTAAACCATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020183.3-1555s1c1
Sequence:CCGGGCTGGTAGTATTGGAACAGATCTCGAGATCTGTTCCAATACTACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020183.3-248s1c1
Sequence:CCGGCCCTTACCTATCTTCTTTCAACTCGAGTTGAAAGAAGATAGGTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020183.3-682s21c1
Sequence:CCGGTTGACTGGACAAAGCTTATTTCTCGAGAAATAAGCTTTGTCCAGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020183.3-868s21c1
Sequence:CCGGTGTCGGATAAAGAGTTGTAAACTCGAGTTTACAACTCTTTATCCGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020183.3-478s21c1
Sequence:CCGGGTTCAACACTTGAGATCTTTACTCGAGTAAAGATCTCAAGTGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020183
ARNTL2 MISSION shRNA Lentiviral Transduction Particles
aryl hydrocarbon receptor nuclear translocator-like 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020183.3-439s1c1
Sequence:CCGGGCGCGTAAACTGGACAAACTTCTCGAGAAGTTTGTCCAGTTTACGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020183.3-987s1c1
Sequence:CCGGGCCTCCAAATATTGTTGGAATCTCGAGATTCCAACAATATTTGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020183.3-1364s1c1
Sequence:CCGGGCCAATGGTTTAGTTTCACAACTCGAGTTGTGAAACTAAACCATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020183.3-1555s1c1
Sequence:CCGGGCTGGTAGTATTGGAACAGATCTCGAGATCTGTTCCAATACTACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020183.3-248s1c1
Sequence:CCGGCCCTTACCTATCTTCTTTCAACTCGAGTTGAAAGAAGATAGGTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020183.3-682s21c1
Sequence:CCGGTTGACTGGACAAAGCTTATTTCTCGAGAAATAAGCTTTGTCCAGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020183.3-868s21c1
Sequence:CCGGTGTCGGATAAAGAGTTGTAAACTCGAGTTTACAACTCTTTATCCGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020183.3-478s21c1
Sequence:CCGGGTTCAACACTTGAGATCTTTACTCGAGTAAAGATCTCAAGTGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks