EMAIL THIS PAGE TO A FRIEND

ARNTL

aryl hydrocarbon receptor nuclear translocator-like

114 Gene Product Result for
Synonyms: BMAL1 BMAL1c JAP3 MOP3 PASD3 TIC bHLHe5
Gene ID:
Human(406) Summary: The protein encoded by this gene is a basic helix-loop-helix protein that forms a heterodimer with CLOCK. This complex binds an E-box upstream of the PER1 gene, activating this gene and possibly other circadian rhythym-associated genes. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(11865) aryl hydrocarbon receptor nuclear translocator-like
Rat(29657) aryl hydrocarbon receptor nuclear translocator-like
chicken(374115) aryl hydrocarbon receptor nuclear translocator-like
cow(530705) aryl hydrocarbon receptor nuclear translocator-like
Horse(100034115) aryl hydrocarbon receptor nuclear translocator-like
domestic cat(101091727) aryl hydrocarbon receptor nuclear translocator-like
dog(476860) aryl hydrocarbon receptor nuclear translocator-like
naked mole-rat(101717663) aryl hydrocarbon receptor nuclear translocator-like
domestic guinea pig(100712723) aryl hydrocarbon receptor nuclear translocator-like
sheep(443262) aryl hydrocarbon receptor nuclear translocator-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A5860 Anti-ARNTL (291-305) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
A5735 Anti-ARNTL (61-75) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV32002 Anti-ARNTL (AB1) antibody produced in rabbit IgG fraction of antiserum rat, horse, bovine, pig, human, sheep, rabbit, canine, mouse, guinea pig
immunohistochemistry, western blot pricing
AV36822 Anti-ARNTL (AB2) antibody produced in rabbit IgG fraction of antiserum canine, mouse, rabbit, horse, sheep, rat, human, bovine, pig, guinea pig
western blot pricing
SAB1405486 Anti-ARNTL antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB4300614 Anti-ARNTL antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
HPA050938 Anti-ARNTL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB2500166 Anti-BMAL1/ARNTL antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, western blot pricing
SAB4100146 Monoclonal Anti-ARNTL antibody produced in mouse clone ARNTL-A110, culture supernatant human
western blot pricing
SAB5300340 Monoclonal Anti-ARNTL antibody produced in mouse clone 1C5, ascites fluid human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001178 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001178 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001178 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007489 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007489 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007489 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001030272 Rosetta Predictions human pricing
NM_001030273 Rosetta Predictions human pricing
NM_001178 Rosetta Predictions human pricing
NM_024362 Rosetta Predictions rat pricing
NM_007489 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010171 predicted 2264
2 SASI_Hs01_00010173 predicted 1289
3 SASI_Hs01_00010174 predicted 1487
4 SASI_Hs02_00307643 predicted 903
5 SASI_Hs01_00010175 predicted 1449
6 SASI_Hs01_00010176 predicted 886
7 SASI_Hs01_00010177 predicted 1855
8 SASI_Hs01_00010178 predicted 2228
9 SASI_Hs01_00010179 predicted 2291
10 SASI_Hs01_00010180 predicted 1503
11 SASI_Hs01_00010172 predicted 1641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169633 predicted 2334
2 SASI_Hs01_00169635 predicted 1365
3 SASI_Hs01_00169636 predicted 1555
4 SASI_Hs02_00307644 predicted 979
5 SASI_Hs01_00169637 predicted 1517
6 SASI_Hs01_00169638 predicted 959
7 SASI_Hs01_00169639 predicted 1921
8 SASI_Hs01_00169640 predicted 2296
9 SASI_Hs01_00169641 predicted 2362
10 SASI_Hs01_00169642 predicted 1570
11 SASI_Hs01_00169634 predicted 1713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001178 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160393 predicted 2317
2 SASI_Hs01_00160395 predicted 1350
3 SASI_Hs01_00160396 predicted 1539
4 SASI_Hs02_00331306 predicted 962
5 SASI_Hs01_00160397 predicted 1498
6 SASI_Hs01_00160398 predicted 947
7 SASI_Hs01_00160399 predicted 1905
8 SASI_Hs01_00160400 predicted 2284
9 SASI_Hs01_00160401 predicted 2350
10 SASI_Hs01_00160402 predicted 1556
11 SASI_Hs01_00160394 predicted 1696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024362 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070542 predicted 1742
2 SASI_Rn01_00070544 predicted 1613
3 SASI_Rn01_00070545 predicted 1205
4 SASI_Rn01_00070546 predicted 1684
5 SASI_Rn01_00070547 predicted 1578
6 SASI_Rn01_00070548 predicted 1789
7 SASI_Rn01_00070549 predicted 2094
8 SASI_Rn02_00263942 predicted 1870
9 SASI_Rn02_00263943 predicted 2279
10 SASI_Rn02_00263944 predicted 1139
11 SASI_Rn01_00070540 predicted 2323
12 SASI_Rn01_00070541 predicted 1410
13 SASI_Rn01_00070543 predicted 1435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007489 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193230 predicted 2282
2 SASI_Mm01_00193231 predicted 1535
3 SASI_Mm01_00193232 predicted 2425
4 SASI_Mm01_00193233 predicted 2394
5 SASI_Mm01_00193234 predicted 2465
6 SASI_Mm01_00193235 predicted 825
7 SASI_Mm01_00193236 predicted 1675
8 SASI_Mm01_00193237 predicted 1718
9 SASI_Mm02_00311757 predicted 1125
10 SASI_Mm01_00193239 predicted 1765
11 SASI_Mm01_00193238 predicted 2033
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001178
VALIDATED
ARNTL MISSION shRNA Bacterial Glycerol Stock
aryl hydrocarbon receptor nuclear translocator-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001178.4-2084s21c1
Sequence:CCGGAGAACCCAGGTTATCCATATTCTCGAGAATATGGATAACCTGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001178.4-1507s21c1
Sequence:CCGGCTTCTAGGCACATCGTGTTATCTCGAGATAACACGATGTGCCTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001178.4-2305s21c1
Sequence:CCGGGCAACAGCTATAGTATCAAAGCTCGAGCTTTGATACTATAGCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001178.4-1561s21c1
Sequence:CCGGGCAGAATGTCATAGGCAAGTTCTCGAGAACTTGCCTATGACATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001178.4-1434s21c1
Sequence:CCGGGCACGCGATAGATGGAAAGTTCTCGAGAACTTTCCATCTATCGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001178.3-1867s1c1
Sequence:CCGGGCCGAATGATTGCTGAGGAAACTCGAGTTTCCTCAGCAATCATTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001178.3-1409s1c1
Sequence:CCGGGCACGCGATAGATGGAAAGTTCTCGAGAACTTTCCATCTATCGCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001178.3-508s1c1
Sequence:CCGGGCTCCACTGACTACCAAGAAACTCGAGTTTCTTGGTAGTCAGTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001178.3-1536s1c1
Sequence:CCGGGCAGAATGTCATAGGCAAGTTCTCGAGAACTTGCCTATGACATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001178.3-689s1c1
Sequence:CCGGCAACGCAATGTCCAGGAAATTCTCGAGAATTTCCTGGACATTGCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001178
VALIDATED
ARNTL MISSION shRNA shRNA Plasmid DNA
aryl hydrocarbon receptor nuclear translocator-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001178.4-2084s21c1
Sequence:CCGGAGAACCCAGGTTATCCATATTCTCGAGAATATGGATAACCTGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001178.4-1507s21c1
Sequence:CCGGCTTCTAGGCACATCGTGTTATCTCGAGATAACACGATGTGCCTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001178.4-2305s21c1
Sequence:CCGGGCAACAGCTATAGTATCAAAGCTCGAGCTTTGATACTATAGCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001178.4-1561s21c1
Sequence:CCGGGCAGAATGTCATAGGCAAGTTCTCGAGAACTTGCCTATGACATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001178.4-1434s21c1
Sequence:CCGGGCACGCGATAGATGGAAAGTTCTCGAGAACTTTCCATCTATCGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001178.3-1867s1c1
Sequence:CCGGGCCGAATGATTGCTGAGGAAACTCGAGTTTCCTCAGCAATCATTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001178.3-1409s1c1
Sequence:CCGGGCACGCGATAGATGGAAAGTTCTCGAGAACTTTCCATCTATCGCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001178.3-508s1c1
Sequence:CCGGGCTCCACTGACTACCAAGAAACTCGAGTTTCTTGGTAGTCAGTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001178.3-1536s1c1
Sequence:CCGGGCAGAATGTCATAGGCAAGTTCTCGAGAACTTGCCTATGACATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001178.3-689s1c1
Sequence:CCGGCAACGCAATGTCCAGGAAATTCTCGAGAATTTCCTGGACATTGCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001178
VALIDATED
ARNTL MISSION shRNA Lentiviral Transduction Particles
aryl hydrocarbon receptor nuclear translocator-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001178.4-2084s21c1
Sequence:CCGGAGAACCCAGGTTATCCATATTCTCGAGAATATGGATAACCTGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001178.4-1507s21c1
Sequence:CCGGCTTCTAGGCACATCGTGTTATCTCGAGATAACACGATGTGCCTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001178.4-2305s21c1
Sequence:CCGGGCAACAGCTATAGTATCAAAGCTCGAGCTTTGATACTATAGCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001178.4-1561s21c1
Sequence:CCGGGCAGAATGTCATAGGCAAGTTCTCGAGAACTTGCCTATGACATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001178.4-1434s21c1
Sequence:CCGGGCACGCGATAGATGGAAAGTTCTCGAGAACTTTCCATCTATCGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001178.3-1867s1c1
Sequence:CCGGGCCGAATGATTGCTGAGGAAACTCGAGTTTCCTCAGCAATCATTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001178.3-1409s1c1
Sequence:CCGGGCACGCGATAGATGGAAAGTTCTCGAGAACTTTCCATCTATCGCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001178.3-508s1c1
Sequence:CCGGGCTCCACTGACTACCAAGAAACTCGAGTTTCTTGGTAGTCAGTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001178.3-1536s1c1
Sequence:CCGGGCAGAATGTCATAGGCAAGTTCTCGAGAACTTGCCTATGACATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001178.3-689s1c1
Sequence:CCGGCAACGCAATGTCCAGGAAATTCTCGAGAATTTCCTGGACATTGCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007489
ARNTL MISSION shRNA Bacterial Glycerol Stock
aryl hydrocarbon receptor nuclear translocator-like
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007489.3-2253s21c1
Sequence:CCGGACATAGGCATCGATATGATAGCTCGAGCTATCATATCGATGCCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007489.3-1047s21c1
Sequence:CCGGTCTTCAAGATCCTCAATTATACTCGAGTATAATTGAGGATCTTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007489.3-953s21c1
Sequence:CCGGGACGAACTGAAACACCTAATTCTCGAGAATTAGGTGTTTCAGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007489.3-2428s21c1
Sequence:CCGGGCAGTATCAAAGTGCATTAATCTCGAGATTAATGCACTTTGATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007489.1-574s1c1
Sequence:CCGGCCCTCATGGAAGGTTAGAATACTCGAGTATTCTAACCTTCCATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007489.1-1433s1c1
Sequence:CCGGCGACACGCAATAGATGGGAAACTCGAGTTTCCCATCTATTGCGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007489.1-1010s1c1
Sequence:CCGGGCCAAAGTTAAGGAACAGCTACTCGAGTAGCTGTTCCTTAACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007489.1-1903s1c1
Sequence:CCGGCGCGGAGGAAATCATGGAAATCTCGAGATTTCCATGATTTCCTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007489.1-2418s1c1
Sequence:CCGGCCATTGATACAAGTCAATCTACTCGAGTAGATTGACTTGTATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007489
ARNTL MISSION shRNA shRNA Plasmid DNA
aryl hydrocarbon receptor nuclear translocator-like
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007489.3-2253s21c1
Sequence:CCGGACATAGGCATCGATATGATAGCTCGAGCTATCATATCGATGCCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007489.3-1047s21c1
Sequence:CCGGTCTTCAAGATCCTCAATTATACTCGAGTATAATTGAGGATCTTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007489.3-953s21c1
Sequence:CCGGGACGAACTGAAACACCTAATTCTCGAGAATTAGGTGTTTCAGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007489.3-2428s21c1
Sequence:CCGGGCAGTATCAAAGTGCATTAATCTCGAGATTAATGCACTTTGATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007489.1-574s1c1
Sequence:CCGGCCCTCATGGAAGGTTAGAATACTCGAGTATTCTAACCTTCCATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007489.1-1433s1c1
Sequence:CCGGCGACACGCAATAGATGGGAAACTCGAGTTTCCCATCTATTGCGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007489.1-1010s1c1
Sequence:CCGGGCCAAAGTTAAGGAACAGCTACTCGAGTAGCTGTTCCTTAACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007489.1-1903s1c1
Sequence:CCGGCGCGGAGGAAATCATGGAAATCTCGAGATTTCCATGATTTCCTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007489.1-2418s1c1
Sequence:CCGGCCATTGATACAAGTCAATCTACTCGAGTAGATTGACTTGTATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007489
ARNTL MISSION shRNA Lentiviral Transduction Particles
aryl hydrocarbon receptor nuclear translocator-like
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007489.3-2253s21c1
Sequence:CCGGACATAGGCATCGATATGATAGCTCGAGCTATCATATCGATGCCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007489.3-1047s21c1
Sequence:CCGGTCTTCAAGATCCTCAATTATACTCGAGTATAATTGAGGATCTTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007489.3-953s21c1
Sequence:CCGGGACGAACTGAAACACCTAATTCTCGAGAATTAGGTGTTTCAGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007489.3-2428s21c1
Sequence:CCGGGCAGTATCAAAGTGCATTAATCTCGAGATTAATGCACTTTGATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007489.1-574s1c1
Sequence:CCGGCCCTCATGGAAGGTTAGAATACTCGAGTATTCTAACCTTCCATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007489.1-1433s1c1
Sequence:CCGGCGACACGCAATAGATGGGAAACTCGAGTTTCCCATCTATTGCGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007489.1-1010s1c1
Sequence:CCGGGCCAAAGTTAAGGAACAGCTACTCGAGTAGCTGTTCCTTAACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007489.1-1903s1c1
Sequence:CCGGCGCGGAGGAAATCATGGAAATCTCGAGATTTCCATGATTTCCTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007489.1-2418s1c1
Sequence:CCGGCCATTGATACAAGTCAATCTACTCGAGTAGATTGACTTGTATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks