EMAIL THIS PAGE TO A FRIEND

ARPC1A

actin related protein 2/3 complex, subunit 1A, 41kDa

77 Gene Product Result for
Synonyms: Arc40 SOP2Hs SOP2L
UniProtKB ID: Q92747, A4D276, D6W5S1, Q7Z5U8, Q86WU5, Q8IXQ0
Gene ID:
Human(10552) Summary: This gene encodes one of seven subunits of the human Arp2/3 protein complex. This subunit is a member of the SOP2 family of proteins and is most similar to the protein encoded by gene ARPC1B. The similarity between these two proteins suggests that they both may function as p41 subunit of the human Arp2/3 complex that has been implicated in the control of actin polymerization in cells. It is possible that the p41 subunit is involved in assembling and maintaining the structure of the Arp2/3 complex. Multiple versions of the p41 subunit may adapt the functions of the complex to different cell types or developmental stages. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Mouse(56443) actin related protein 2/3 complex, subunit 1A
Rat(81824) actin related protein 2/3 complex, subunit 1A
Zebrafish(394243) actin related protein 2/3 complex, subunit 1A
Thale Cress(817641) actin-related protein C1A
chicken(770269) actin related protein 2/3 complex, subunit 1A, 41kDa
cow(508402) actin related protein 2/3 complex, subunit 1A, 41kDa
Horse(100059256) actin related protein 2/3 complex, subunit 1A, 41kDa
domestic cat(101084410) actin related protein 2/3 complex, subunit 1A, 41kDa
dog(479745) actin related protein 2/3 complex, subunit 1A, 41kDa
sheep(101113818) actin related protein 2/3 complex, subunit 1A, 41kDa
naked mole-rat(101724607) actin related protein 2/3 complex, subunit 1A, 41kDa
domestic guinea pig(100723542) actin related protein 2/3 complex, subunit 1A, 41kDa
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006409 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006409 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006409 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019767 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019767 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019767 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006409 Rosetta Predictions human pricing
NM_031146 Rosetta Predictions rat pricing
XM_579506 Rosetta Predictions rat pricing
NM_019767 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121761 predicted 1191
2 SASI_Hs02_00341504 predicted 584
3 SASI_Hs01_00121762 predicted 1185
4 SASI_Hs01_00121763 predicted 230
5 SASI_Hs01_00121764 predicted 1157
6 SASI_Hs01_00121765 predicted 893
7 SASI_Hs01_00121766 predicted 493
8 SASI_Hs01_00121768 predicted 849
9 SASI_Hs01_00121769 predicted 1040
10 SASI_Hs01_00121770 predicted 980
11 SASI_Hs01_00121767 predicted 370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031146 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078535 predicted 1155
2 SASI_Rn01_00078536 predicted 1120
3 SASI_Rn01_00078537 predicted 1039
4 SASI_Rn02_00264485 predicted 321
5 SASI_Rn02_00264486 predicted 1193
6 SASI_Rn01_00078539 predicted 1076
7 SASI_Rn01_00078540 predicted 923
8 SASI_Rn01_00078541 predicted 315
9 SASI_Rn02_00264487 predicted 300
10 SASI_Rn01_00078544 predicted 542
11 SASI_Rn01_00078538 predicted 1074
12 SASI_Rn01_00078542 predicted 525
13 SASI_Rn01_00078543 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579506 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00151023 predicted 253
2 SASI_Rn01_00151024 predicted 219
3 SASI_Rn01_00151025 predicted 291
4 SASI_Rn01_00151026 predicted 208
5 SASI_Rn01_00151027 predicted 299
6 SASI_Rn01_00151028 predicted 257
7 SASI_Rn01_00151029 predicted 217
8 SASI_Rn01_00151030 predicted 291
9 SASI_Rn01_00151031 predicted 305
10 SASI_Rn01_00151032 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019767 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170296 predicted 1142
2 SASI_Mm01_00170297 predicted 1172
3 SASI_Mm01_00170298 predicted 980
4 SASI_Mm01_00170299 predicted 356
5 SASI_Mm01_00170300 predicted 311
6 SASI_Mm01_00170301 predicted 291
7 SASI_Mm01_00170302 predicted 414
8 SASI_Mm01_00170304 predicted 1111
9 SASI_Mm01_00170305 predicted 299
10 SASI_Mm02_00324957 predicted 1025
11 SASI_Mm01_00170303 predicted 1024
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006409
VALIDATED
ARPC1A MISSION shRNA Bacterial Glycerol Stock
actin related protein 2/3 complex, subunit 1A, 41kDa
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006409.2-488s21c1
Sequence:GTACCGGGAAGTGGAGCACGACTCATTTCTCGAGAAATGAGTCGTGCTCCACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006409.2-302s21c1
Sequence:GTACCGGACGGACACATCACAGGTATTGCTCGAGCAATACCTGTGATGTGTCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006409.2-1154s21c1
Sequence:GTACCGGACAAGCAAGATTGTCGCAAATCTCGAGATTTGCGACAATCTTGCTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006409.2-1200s21c1
Sequence:CCGGCATGACAATTTGGGATTTCAACTCGAGTTGAAATCCCAAATTGTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006409.2-889s21c1
Sequence:CCGGCCGCTCCTAAGTGTGTCATTTCTCGAGAAATGACACACTTAGGAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006409.2-413s21c1
Sequence:CCGGCCCTGGTGATCCTGAGAATTACTCGAGTAATTCTCAGGATCACCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006409.2-1457s21c1
Sequence:CCGGGCGATTTCATTCCATTCTTGACTCGAGTCAAGAATGGAATGAAATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005366    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006409.2-1457s1c1
Sequence:CCGGGCGATTTCATTCCATTCTTGACTCGAGTCAAGAATGGAATGAAATCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006409.2-889s1c1
Sequence:CCGGCCGCTCCTAAGTGTGTCATTTCTCGAGAAATGACACACTTAGGAGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006409.2-658s1c1
Sequence:CCGGGCCTACATTAAAGAAGTGGATCTCGAGATCCACTTCTTTAATGTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006409.2-1200s1c1
Sequence:CCGGCATGACAATTTGGGATTTCAACTCGAGTTGAAATCCCAAATTGTCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006409.2-413s1c1
Sequence:CCGGCCCTGGTGATCCTGAGAATTACTCGAGTAATTCTCAGGATCACCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006409
VALIDATED
ARPC1A MISSION shRNA shRNA Plasmid DNA
actin related protein 2/3 complex, subunit 1A, 41kDa
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006409.2-488s21c1
Sequence:GTACCGGGAAGTGGAGCACGACTCATTTCTCGAGAAATGAGTCGTGCTCCACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006409.2-302s21c1
Sequence:GTACCGGACGGACACATCACAGGTATTGCTCGAGCAATACCTGTGATGTGTCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006409.2-1154s21c1
Sequence:GTACCGGACAAGCAAGATTGTCGCAAATCTCGAGATTTGCGACAATCTTGCTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006409.2-1200s21c1
Sequence:CCGGCATGACAATTTGGGATTTCAACTCGAGTTGAAATCCCAAATTGTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006409.2-889s21c1
Sequence:CCGGCCGCTCCTAAGTGTGTCATTTCTCGAGAAATGACACACTTAGGAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006409.2-413s21c1
Sequence:CCGGCCCTGGTGATCCTGAGAATTACTCGAGTAATTCTCAGGATCACCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006409.2-1457s21c1
Sequence:CCGGGCGATTTCATTCCATTCTTGACTCGAGTCAAGAATGGAATGAAATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005366    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006409.2-1457s1c1
Sequence:CCGGGCGATTTCATTCCATTCTTGACTCGAGTCAAGAATGGAATGAAATCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006409.2-889s1c1
Sequence:CCGGCCGCTCCTAAGTGTGTCATTTCTCGAGAAATGACACACTTAGGAGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006409.2-658s1c1
Sequence:CCGGGCCTACATTAAAGAAGTGGATCTCGAGATCCACTTCTTTAATGTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006409.2-1200s1c1
Sequence:CCGGCATGACAATTTGGGATTTCAACTCGAGTTGAAATCCCAAATTGTCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006409.2-413s1c1
Sequence:CCGGCCCTGGTGATCCTGAGAATTACTCGAGTAATTCTCAGGATCACCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006409
VALIDATED
ARPC1A MISSION shRNA Lentiviral Transduction Particles
actin related protein 2/3 complex, subunit 1A, 41kDa
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006409.2-488s21c1
Sequence:GTACCGGGAAGTGGAGCACGACTCATTTCTCGAGAAATGAGTCGTGCTCCACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006409.2-302s21c1
Sequence:GTACCGGACGGACACATCACAGGTATTGCTCGAGCAATACCTGTGATGTGTCCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006409.2-1154s21c1
Sequence:GTACCGGACAAGCAAGATTGTCGCAAATCTCGAGATTTGCGACAATCTTGCTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006409.2-1200s21c1
Sequence:CCGGCATGACAATTTGGGATTTCAACTCGAGTTGAAATCCCAAATTGTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006409.2-889s21c1
Sequence:CCGGCCGCTCCTAAGTGTGTCATTTCTCGAGAAATGACACACTTAGGAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006409.2-413s21c1
Sequence:CCGGCCCTGGTGATCCTGAGAATTACTCGAGTAATTCTCAGGATCACCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006409.2-1457s21c1
Sequence:CCGGGCGATTTCATTCCATTCTTGACTCGAGTCAAGAATGGAATGAAATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005366    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006409.2-1457s1c1
Sequence:CCGGGCGATTTCATTCCATTCTTGACTCGAGTCAAGAATGGAATGAAATCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006409.2-889s1c1
Sequence:CCGGCCGCTCCTAAGTGTGTCATTTCTCGAGAAATGACACACTTAGGAGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006409.2-658s1c1
Sequence:CCGGGCCTACATTAAAGAAGTGGATCTCGAGATCCACTTCTTTAATGTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006409.2-1200s1c1
Sequence:CCGGCATGACAATTTGGGATTTCAACTCGAGTTGAAATCCCAAATTGTCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006409.2-413s1c1
Sequence:CCGGCCCTGGTGATCCTGAGAATTACTCGAGTAATTCTCAGGATCACCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019767
VALIDATED
ARPC1A MISSION shRNA Bacterial Glycerol Stock
actin related protein 2/3 complex, subunit 1A, 41kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019767.2-939s21c1
Sequence:CCGGCCGATGCTCTTTAACTACGATCTCGAGATCGTAGTTAAAGAGCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019767.2-360s21c1
Sequence:CCGGGCCTATGTCTGGAGTCAGAAACTCGAGTTTCTGACTCCAGACATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019767.2-1348s21c1
Sequence:CCGGCTGAAGCAACTAGCGTGTGTTCTCGAGAACACACGCTAGTTGCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019767.2-1174s21c1
Sequence:CCGGGCATTGATGGAGCCATGACAACTCGAGTTGTCATGGCTCCATCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019767.2-1142s21c1
Sequence:CCGGCAAGCAAGATTGTCGCAAATTCTCGAGAATTTGCGACAATCTTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019767.1-1348s1c1
Sequence:CCGGCTGAAGCAACTAGCGTGTGTTCTCGAGAACACACGCTAGTTGCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019767.1-939s1c1
Sequence:CCGGCCGATGCTCTTTAACTACGATCTCGAGATCGTAGTTAAAGAGCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019767.1-360s1c1
Sequence:CCGGGCCTATGTCTGGAGTCAGAAACTCGAGTTTCTGACTCCAGACATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019767.1-1174s1c1
Sequence:CCGGGCATTGATGGAGCCATGACAACTCGAGTTGTCATGGCTCCATCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019767.1-1142s1c1
Sequence:CCGGCAAGCAAGATTGTCGCAAATTCTCGAGAATTTGCGACAATCTTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019767
VALIDATED
ARPC1A MISSION shRNA shRNA Plasmid DNA
actin related protein 2/3 complex, subunit 1A, 41kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019767.2-939s21c1
Sequence:CCGGCCGATGCTCTTTAACTACGATCTCGAGATCGTAGTTAAAGAGCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019767.2-360s21c1
Sequence:CCGGGCCTATGTCTGGAGTCAGAAACTCGAGTTTCTGACTCCAGACATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019767.2-1348s21c1
Sequence:CCGGCTGAAGCAACTAGCGTGTGTTCTCGAGAACACACGCTAGTTGCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019767.2-1174s21c1
Sequence:CCGGGCATTGATGGAGCCATGACAACTCGAGTTGTCATGGCTCCATCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019767.2-1142s21c1
Sequence:CCGGCAAGCAAGATTGTCGCAAATTCTCGAGAATTTGCGACAATCTTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019767.1-1348s1c1
Sequence:CCGGCTGAAGCAACTAGCGTGTGTTCTCGAGAACACACGCTAGTTGCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019767.1-939s1c1
Sequence:CCGGCCGATGCTCTTTAACTACGATCTCGAGATCGTAGTTAAAGAGCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019767.1-360s1c1
Sequence:CCGGGCCTATGTCTGGAGTCAGAAACTCGAGTTTCTGACTCCAGACATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019767.1-1174s1c1
Sequence:CCGGGCATTGATGGAGCCATGACAACTCGAGTTGTCATGGCTCCATCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019767.1-1142s1c1
Sequence:CCGGCAAGCAAGATTGTCGCAAATTCTCGAGAATTTGCGACAATCTTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019767
VALIDATED
ARPC1A MISSION shRNA Lentiviral Transduction Particles
actin related protein 2/3 complex, subunit 1A, 41kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019767.2-939s21c1
Sequence:CCGGCCGATGCTCTTTAACTACGATCTCGAGATCGTAGTTAAAGAGCATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019767.2-360s21c1
Sequence:CCGGGCCTATGTCTGGAGTCAGAAACTCGAGTTTCTGACTCCAGACATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019767.2-1348s21c1
Sequence:CCGGCTGAAGCAACTAGCGTGTGTTCTCGAGAACACACGCTAGTTGCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019767.2-1174s21c1
Sequence:CCGGGCATTGATGGAGCCATGACAACTCGAGTTGTCATGGCTCCATCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019767.2-1142s21c1
Sequence:CCGGCAAGCAAGATTGTCGCAAATTCTCGAGAATTTGCGACAATCTTGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019767.1-1348s1c1
Sequence:CCGGCTGAAGCAACTAGCGTGTGTTCTCGAGAACACACGCTAGTTGCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019767.1-939s1c1
Sequence:CCGGCCGATGCTCTTTAACTACGATCTCGAGATCGTAGTTAAAGAGCATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019767.1-360s1c1
Sequence:CCGGGCCTATGTCTGGAGTCAGAAACTCGAGTTTCTGACTCCAGACATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019767.1-1174s1c1
Sequence:CCGGGCATTGATGGAGCCATGACAACTCGAGTTGTCATGGCTCCATCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019767.1-1142s1c1
Sequence:CCGGCAAGCAAGATTGTCGCAAATTCTCGAGAATTTGCGACAATCTTGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)