EMAIL THIS PAGE TO A FRIEND

ARPC1B

actin related protein 2/3 complex, subunit 1B, 41kDa

70 Gene Product Result for
Synonyms: ARC41 p40-ARC p41-ARC
UniProtKB ID: O15143, Q9BU00
Gene ID:
Human(10095) Summary: This gene encodes one of seven subunits of the human Arp2/3 protein complex. This subunit is a member of the SOP2 family of proteins and is most similar to the protein encoded by gene ARPC1A. The similarity between these two proteins suggests that they both may function as p41 subunit of the human Arp2/3 complex that has been implicated in the control of actin polymerization in cells. It is possible that the p41 subunit is involved in assembling and maintaining the structure of the Arp2/3 complex. Multiple versions of the p41 subunit may adapt the functions of the complex to different cell types or developmental stages. This protein also has a role in centrosomal homeostasis by being an activator and substrate of the Aurora A kinase. [provided by RefSeq, Mar 2011]
Mouse(11867) actin related protein 2/3 complex, subunit 1B
Rat(54227) actin related protein 2/3 complex, subunit 1B
domestic guinea pig(100723268) actin related protein 2/3 complex, subunit 1B, 41kDa
naked mole-rat(101725609) actin related protein 2/3 complex, subunit 1B, 41kDa
sheep(101113558) actin related protein 2/3 complex, subunit 1B, 41kDa
Domestic Rabbit(100346759) actin related protein 2/3 complex, subunit 1B, 41kDa
Zebrafish(335474) actin related protein 2/3 complex, subunit 1B
chicken(416490) actin related protein 2/3 complex, subunit 1B, 41kDa
Thale Cress(817687) actin-related protein C1B
dog(479744) actin related protein 2/3 complex, subunit 1B, 41kDa
domestic cat(101084672) actin related protein 2/3 complex, subunit 1B, 41kDa
cow(326600) actin related protein 2/3 complex, subunit 1B, 41kDa
Horse(100059292) actin related protein 2/3 complex, subunit 1B, 41kDa
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023142 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023142 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023142 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005720 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005720 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005720 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007891 MISSION® esiRNA esiRNA targeting human ARPC1B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005720 Rosetta Predictions human pricing
NM_019289 Rosetta Predictions rat pricing
NM_023142 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051038 predicted 462
2 SASI_Hs01_00051039 predicted 695
3 SASI_Hs01_00051040 predicted 1044
4 SASI_Hs01_00051041 predicted 275
5 SASI_Hs01_00051043 predicted 348
6 SASI_Hs01_00051044 predicted 1131
7 SASI_Hs01_00051045 predicted 433
8 SASI_Hs01_00051046 predicted 829
9 SASI_Hs01_00051047 predicted 573
10 SASI_Hs02_00340139 predicted 291
11 SASI_Hs01_00051042 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019289 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262231 predicted 278
2 SASI_Rn02_00262232 predicted 307
3 SASI_Rn02_00262233 predicted 967
4 SASI_Rn02_00262234 predicted 732
5 SASI_Rn02_00262235 predicted 663
6 SASI_Rn01_00034705 predicted 565
7 SASI_Rn02_00262236 predicted 270
8 SASI_Rn01_00034706 predicted 1263
9 SASI_Rn02_00262237 predicted 595
10 SASI_Rn02_00262238 predicted 1061
11 SASI_Rn01_00034704 predicted 773
12 SASI_Rn01_00034707 predicted 588
13 SASI_Rn01_00034708 predicted 1222
14 SASI_Rn01_00034709 predicted 1272
15 SASI_Rn01_00034710 predicted 1318
16 SASI_Rn01_00034711 predicted 1449
17 SASI_Rn01_00034712 predicted 1448
18 SASI_Rn01_00034713 predicted 1294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023142 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326861 predicted 329
2 SASI_Mm02_00326862 predicted 940
3 SASI_Mm02_00326863 predicted 838
4 SASI_Mm02_00326864 predicted 680
5 SASI_Mm02_00326865 predicted 746
6 SASI_Mm02_00326866 predicted 588
7 SASI_Mm02_00326867 predicted 291
8 SASI_Mm02_00326868 predicted 1113
9 SASI_Mm02_00326869 predicted 592
10 SASI_Mm02_00326870 predicted 457
11 SASI_Mm01_00115449 predicted 1221
12 SASI_Mm01_00115450 predicted 1285
13 SASI_Mm01_00115451 predicted 1219
14 SASI_Mm01_00115452 predicted 1428
15 SASI_Mm01_00115453 predicted 1254
16 SASI_Mm01_00115454 predicted 1242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023142
ARPC1B MISSION shRNA Bacterial Glycerol Stock
actin related protein 2/3 complex, subunit 1B, 41kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023142.1-1233s1c1
Sequence:CCGGGAATGTTTCTAGGATGCAGTACTCGAGTACTGCATCCTAGAAACATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023142.1-990s1c1
Sequence:CCGGCCTGGATTCACTGCACAAGAACTCGAGTTCTTGTGCAGTGAATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023142.1-1002s1c1
Sequence:CCGGGCACAAGAACAGTGTCAGCCACTCGAGTGGCTGACACTGTTCTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023142.1-528s1c1
Sequence:CCGGCAGGATCTTCTCTGCCTATATCTCGAGATATAGGCAGAGAAGATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023142.1-348s1c1
Sequence:CCGGCAATGAGAACAAGTTCCGCGTCTCGAGACGCGGAACTTGTTCTCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023142
ARPC1B MISSION shRNA shRNA Plasmid DNA
actin related protein 2/3 complex, subunit 1B, 41kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023142.1-1233s1c1
Sequence:CCGGGAATGTTTCTAGGATGCAGTACTCGAGTACTGCATCCTAGAAACATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023142.1-990s1c1
Sequence:CCGGCCTGGATTCACTGCACAAGAACTCGAGTTCTTGTGCAGTGAATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023142.1-1002s1c1
Sequence:CCGGGCACAAGAACAGTGTCAGCCACTCGAGTGGCTGACACTGTTCTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023142.1-528s1c1
Sequence:CCGGCAGGATCTTCTCTGCCTATATCTCGAGATATAGGCAGAGAAGATCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023142.1-348s1c1
Sequence:CCGGCAATGAGAACAAGTTCCGCGTCTCGAGACGCGGAACTTGTTCTCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023142
ARPC1B MISSION shRNA Lentiviral Transduction Particles
actin related protein 2/3 complex, subunit 1B, 41kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023142.1-1233s1c1
Sequence:CCGGGAATGTTTCTAGGATGCAGTACTCGAGTACTGCATCCTAGAAACATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023142.1-990s1c1
Sequence:CCGGCCTGGATTCACTGCACAAGAACTCGAGTTCTTGTGCAGTGAATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023142.1-1002s1c1
Sequence:CCGGGCACAAGAACAGTGTCAGCCACTCGAGTGGCTGACACTGTTCTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023142.1-528s1c1
Sequence:CCGGCAGGATCTTCTCTGCCTATATCTCGAGATATAGGCAGAGAAGATCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023142.1-348s1c1
Sequence:CCGGCAATGAGAACAAGTTCCGCGTCTCGAGACGCGGAACTTGTTCTCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005720
VALIDATED
ARPC1B MISSION shRNA Bacterial Glycerol Stock
actin related protein 2/3 complex, subunit 1B, 41kDa
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005720.2-836s1c1
Sequence:CCGGGCTGACCTTCATCACAGACAACTCGAGTTGTCTGTGATGAAGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005720.2-491s1c1
Sequence:CCGGCAAGCACATCAAGAAGCCCATCTCGAGATGGGCTTCTTGATGTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005720.2-697s1c1
Sequence:CCGGGCTGGGTACATGGCGTCTGTTCTCGAGAACAGACGCCATGTACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005720.2-405s1c1
Sequence:CCGGCCCAACGAGAACAAGTTTGCTCTCGAGAGCAAACTTGTTCTCGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005720.2-177s1c1
Sequence:CCGGCATGAGGTGCATATCTATGAACTCGAGTTCATAGATATGCACCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005720.2-1222s21c1
Sequence:GTACCGGTGTTGCCTTCATCCTAGCTGCCTCGAGGCAGCTAGGATGAAGGCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_005720.2-1214s21c1
Sequence:GTACCGGGAGGAATATGTTGCCTTCATCCTCGAGGATGAAGGCAACATATTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005720.2-177s21c1
Sequence:CCGGCATGAGGTGCATATCTATGAACTCGAGTTCATAGATATGCACCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005720.2-697s21c1
Sequence:CCGGGCTGGGTACATGGCGTCTGTTCTCGAGAACAGACGCCATGTACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005720.2-836s21c1
Sequence:CCGGGCTGACCTTCATCACAGACAACTCGAGTTGTCTGTGATGAAGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005720.2-1137s21c1
Sequence:CCGGATGGATGGCGGCATGAGTATCCTCGAGGATACTCATGCCGCCATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005720.2-576s21c1
Sequence:GTACCGGGACTTCAAGTGTCGGATCTTTCTCGAGAAAGATCCGACACTTGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005720.2-1202s21c1
Sequence:GTACCGGCAAATGACCTGTGAGGAATATCTCGAGATATTCCTCACAGGTCATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005720
VALIDATED
ARPC1B MISSION shRNA shRNA Plasmid DNA
actin related protein 2/3 complex, subunit 1B, 41kDa
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005720.2-836s1c1
Sequence:CCGGGCTGACCTTCATCACAGACAACTCGAGTTGTCTGTGATGAAGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005720.2-491s1c1
Sequence:CCGGCAAGCACATCAAGAAGCCCATCTCGAGATGGGCTTCTTGATGTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005720.2-697s1c1
Sequence:CCGGGCTGGGTACATGGCGTCTGTTCTCGAGAACAGACGCCATGTACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005720.2-405s1c1
Sequence:CCGGCCCAACGAGAACAAGTTTGCTCTCGAGAGCAAACTTGTTCTCGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005720.2-177s1c1
Sequence:CCGGCATGAGGTGCATATCTATGAACTCGAGTTCATAGATATGCACCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005720.2-1222s21c1
Sequence:GTACCGGTGTTGCCTTCATCCTAGCTGCCTCGAGGCAGCTAGGATGAAGGCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_005720.2-1214s21c1
Sequence:GTACCGGGAGGAATATGTTGCCTTCATCCTCGAGGATGAAGGCAACATATTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005720.2-177s21c1
Sequence:CCGGCATGAGGTGCATATCTATGAACTCGAGTTCATAGATATGCACCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005720.2-697s21c1
Sequence:CCGGGCTGGGTACATGGCGTCTGTTCTCGAGAACAGACGCCATGTACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005720.2-836s21c1
Sequence:CCGGGCTGACCTTCATCACAGACAACTCGAGTTGTCTGTGATGAAGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005720.2-1137s21c1
Sequence:CCGGATGGATGGCGGCATGAGTATCCTCGAGGATACTCATGCCGCCATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005720.2-576s21c1
Sequence:GTACCGGGACTTCAAGTGTCGGATCTTTCTCGAGAAAGATCCGACACTTGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005720.2-1202s21c1
Sequence:GTACCGGCAAATGACCTGTGAGGAATATCTCGAGATATTCCTCACAGGTCATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005720
VALIDATED
ARPC1B MISSION shRNA Lentiviral Transduction Particles
actin related protein 2/3 complex, subunit 1B, 41kDa
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005720.2-836s1c1
Sequence:CCGGGCTGACCTTCATCACAGACAACTCGAGTTGTCTGTGATGAAGGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005720.2-491s1c1
Sequence:CCGGCAAGCACATCAAGAAGCCCATCTCGAGATGGGCTTCTTGATGTGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005720.2-697s1c1
Sequence:CCGGGCTGGGTACATGGCGTCTGTTCTCGAGAACAGACGCCATGTACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005720.2-405s1c1
Sequence:CCGGCCCAACGAGAACAAGTTTGCTCTCGAGAGCAAACTTGTTCTCGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005720.2-177s1c1
Sequence:CCGGCATGAGGTGCATATCTATGAACTCGAGTTCATAGATATGCACCTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005720.2-1222s21c1
Sequence:GTACCGGTGTTGCCTTCATCCTAGCTGCCTCGAGGCAGCTAGGATGAAGGCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_005720.2-1214s21c1
Sequence:GTACCGGGAGGAATATGTTGCCTTCATCCTCGAGGATGAAGGCAACATATTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005720.2-177s21c1
Sequence:CCGGCATGAGGTGCATATCTATGAACTCGAGTTCATAGATATGCACCTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005720.2-697s21c1
Sequence:CCGGGCTGGGTACATGGCGTCTGTTCTCGAGAACAGACGCCATGTACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005720.2-836s21c1
Sequence:CCGGGCTGACCTTCATCACAGACAACTCGAGTTGTCTGTGATGAAGGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005720.2-1137s21c1
Sequence:CCGGATGGATGGCGGCATGAGTATCCTCGAGGATACTCATGCCGCCATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005720.2-576s21c1
Sequence:GTACCGGGACTTCAAGTGTCGGATCTTTCTCGAGAAAGATCCGACACTTGAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005720.2-1202s21c1
Sequence:GTACCGGCAAATGACCTGTGAGGAATATCTCGAGATATTCCTCACAGGTCATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)