EMAIL THIS PAGE TO A FRIEND

ARPC2

actin related protein 2/3 complex, subunit 2, 34kDa

134 Gene Product Result for
Synonyms: ARC34 PNAS-139 p34-Arc
UniProtKB ID: O15144, Q92801, Q9P1D4
Gene ID:
Human(10109) Summary: This gene encodes one of seven subunits of the human Arp2/3 protein complex. The Arp2/3 protein complex has been implicated in the control of actin polymerization in cells and has been conserved through evolution. The exact role of the protein encoded by this gene, the p34 subunit, has yet to be determined. Two alternatively spliced variants have been characterized to date. Additional alternatively spliced variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(76709) actin related protein 2/3 complex, subunit 2
Rat(301511) actin related protein 2/3 complex, subunit 2
Zebrafish(327068) actin related protein 2/3 complex, subunit 2
chicken(429041) actin related protein 2/3 complex, subunit 2, 34kDa
fruit fly(35311) Actin-related protein 2/3 complex, subunit 2
cow(540838) actin related protein 2/3 complex, subunit 2, 34kDa
domestic cat(101085911) actin related protein 2/3 complex, subunit 2, 34kDa
dog(478907) actin related protein 2/3 complex, subunit 2, 34kDa
sheep(101110485) actin related protein 2/3 complex, subunit 2, 34kDa
naked mole-rat(101711880) actin related protein 2/3 complex, subunit 2, 34kDa
domestic guinea pig(100723870) actin related protein 2/3 complex, subunit 2, 34kDa
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005731 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005731 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005731 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029711 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029711 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029711 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_129773 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_129773 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_129773 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005731 Rosetta Predictions human pricing
NM_152862 Rosetta Predictions human pricing
NM_001106919 Rosetta Predictions rat pricing
NM_029711 Rosetta Predictions mouse pricing
XM_129773 Rosetta Predictions mouse pricing
XM_901710 Rosetta Predictions mouse pricing
XM_901712 Rosetta Predictions mouse pricing
XM_901713 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005731 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135336 predicted 481
2 SASI_Hs02_00340161 predicted 554
3 SASI_Hs01_00135337 predicted 517
4 SASI_Hs01_00135338 predicted 717
5 SASI_Hs01_00135339 predicted 840
6 SASI_Hs01_00135340 predicted 777
7 SASI_Hs01_00135341 predicted 729
8 SASI_Hs01_00135342 predicted 569
9 SASI_Hs02_00340162 predicted 561
10 SASI_Hs02_00340163 predicted 667
11 SASI_Hs01_00135343 predicted 498
12 SASI_Hs01_00135344 predicted 270
13 SASI_Hs01_00135345 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137874 predicted 517
2 SASI_Hs02_00366805 predicted 586
3 SASI_Hs01_00137875 predicted 555
4 SASI_Hs01_00137876 predicted 758
5 SASI_Hs01_00137877 predicted 877
6 SASI_Hs01_00137878 predicted 813
7 SASI_Hs01_00137879 predicted 773
8 SASI_Hs01_00137880 predicted 613
9 SASI_Hs02_00366806 predicted 600
10 SASI_Hs02_00366807 predicted 700
11 SASI_Hs01_00137881 predicted 538
12 SASI_Hs01_00137882 predicted 306
13 SASI_Hs01_00137883 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106919 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223696 predicted 886
2 SASI_Rn02_00223697 predicted 343
3 SASI_Rn02_00223698 predicted 855
4 SASI_Rn02_00223699 predicted 568
5 SASI_Rn02_00223700 predicted 539
6 SASI_Rn02_00223701 predicted 826
7 SASI_Rn02_00223702 predicted 524
8 SASI_Rn02_00223703 predicted 1063
9 SASI_Rn02_00223704 predicted 772
10 SASI_Rn02_00223705 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029711 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335785 predicted 394
2 SASI_Mm02_00335786 predicted 1036
3 SASI_Mm02_00335787 predicted 1043
4 SASI_Mm02_00335788 predicted 809
5 SASI_Mm02_00335789 predicted 1020
6 SASI_Mm02_00335790 predicted 982
7 SASI_Mm02_00335791 predicted 614
8 SASI_Mm02_00335792 predicted 759
9 SASI_Mm02_00335793 predicted 507
10 SASI_Mm02_00335794 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129773 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273617 predicted 727
2 SASI_Mm01_00273618 predicted 1024
3 SASI_Mm01_00273619 predicted 801
4 SASI_Mm01_00273620 predicted 539
5 SASI_Mm01_00273621 predicted 782
6 SASI_Mm01_00273622 predicted 574
7 SASI_Mm01_00273623 predicted 944
8 SASI_Mm01_00273624 predicted 729
9 SASI_Mm01_00273625 predicted 504
10 SASI_Mm01_00273626 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901710 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207597 predicted 571
2 SASI_Mm01_00207598 predicted 355
3 SASI_Mm01_00207599 predicted 657
4 SASI_Mm01_00207600 predicted 438
5 SASI_Mm01_00207601 predicted 462
6 SASI_Mm01_00207602 predicted 528
7 SASI_Mm01_00207603 predicted 832
8 SASI_Mm01_00207604 predicted 609
9 SASI_Mm01_00207605 predicted 350
10 SASI_Mm01_00207606 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901712 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255683 predicted 780
2 SASI_Mm01_00255684 predicted 982
3 SASI_Mm01_00255685 predicted 974
4 SASI_Mm01_00255686 predicted 748
5 SASI_Mm01_00255687 predicted 728
6 SASI_Mm01_00255688 predicted 862
7 SASI_Mm01_00255689 predicted 749
8 SASI_Mm01_00255690 predicted 891
9 SASI_Mm01_00255691 predicted 795
10 SASI_Mm01_00255692 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901713 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206798 predicted 613
2 SASI_Mm01_00206799 predicted 535
3 SASI_Mm01_00206800 predicted 624
4 SASI_Mm01_00206801 predicted 394
5 SASI_Mm01_00206802 predicted 430
6 SASI_Mm01_00206803 predicted 499
7 SASI_Mm01_00206804 predicted 791
8 SASI_Mm01_00206805 predicted 432
9 SASI_Mm01_00206806 predicted 577
10 SASI_Mm01_00206807 predicted 554
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005731
VALIDATED
ARPC2 MISSION shRNA Bacterial Glycerol Stock
actin related protein 2/3 complex, subunit 2, 34kDa
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005731.2-1056s21c1
Sequence:GTACCGGTGCGCCTCTTCAGGTTCTTAACTCGAGTTAAGAACCTGAAGAGGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_005731.2-1189s21c1
Sequence:GTACCGGATTCCACTTGATCAACTTAATCTCGAGATTAAGTTGATCAAGTGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005731.2-411s21c1
Sequence:CCGGGCTGGCATGTTGAAGCGAAATCTCGAGATTTCGCTTCAACATGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005731.2-830s21c1
Sequence:CCGGCTACCACATCAAGTGCTCTAACTCGAGTTAGAGCACTTGATGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005731.2-311s21c1
Sequence:CCGGGTACGGGAGTTTCTTGGTAAACTCGAGTTTACCAAGAAACTCCCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005731.2-210s21c1
Sequence:CCGGTCAAATCCTAATGGAGACAAACTCGAGTTTGTCTCCATTAGGATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005731.2-281s21c1
Sequence:GTACCGGACATGGTGCTGATGAGTTATTCTCGAGAATAACTCATCAGCACCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005731.2-210s1c1
Sequence:CCGGTCAAATCCTAATGGAGACAAACTCGAGTTTGTCTCCATTAGGATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005731.2-830s1c1
Sequence:CCGGCTACCACATCAAGTGCTCTAACTCGAGTTAGAGCACTTGATGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_005731.2-311s1c1
Sequence:CCGGGTACGGGAGTTTCTTGGTAAACTCGAGTTTACCAAGAAACTCCCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005731.2-498s1c1
Sequence:CCGGGCAGTTATCCATTATAGGGATCTCGAGATCCCTATAATGGATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005731.2-411s1c1
Sequence:CCGGGCTGGCATGTTGAAGCGAAATCTCGAGATTTCGCTTCAACATGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005731
VALIDATED
ARPC2 MISSION shRNA shRNA Plasmid DNA
actin related protein 2/3 complex, subunit 2, 34kDa
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005731.2-1056s21c1
Sequence:GTACCGGTGCGCCTCTTCAGGTTCTTAACTCGAGTTAAGAACCTGAAGAGGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_005731.2-1189s21c1
Sequence:GTACCGGATTCCACTTGATCAACTTAATCTCGAGATTAAGTTGATCAAGTGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005731.2-411s21c1
Sequence:CCGGGCTGGCATGTTGAAGCGAAATCTCGAGATTTCGCTTCAACATGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005731.2-830s21c1
Sequence:CCGGCTACCACATCAAGTGCTCTAACTCGAGTTAGAGCACTTGATGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005731.2-311s21c1
Sequence:CCGGGTACGGGAGTTTCTTGGTAAACTCGAGTTTACCAAGAAACTCCCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005731.2-210s21c1
Sequence:CCGGTCAAATCCTAATGGAGACAAACTCGAGTTTGTCTCCATTAGGATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005731.2-281s21c1
Sequence:GTACCGGACATGGTGCTGATGAGTTATTCTCGAGAATAACTCATCAGCACCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005731.2-210s1c1
Sequence:CCGGTCAAATCCTAATGGAGACAAACTCGAGTTTGTCTCCATTAGGATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005731.2-830s1c1
Sequence:CCGGCTACCACATCAAGTGCTCTAACTCGAGTTAGAGCACTTGATGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_005731.2-311s1c1
Sequence:CCGGGTACGGGAGTTTCTTGGTAAACTCGAGTTTACCAAGAAACTCCCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005731.2-498s1c1
Sequence:CCGGGCAGTTATCCATTATAGGGATCTCGAGATCCCTATAATGGATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005731.2-411s1c1
Sequence:CCGGGCTGGCATGTTGAAGCGAAATCTCGAGATTTCGCTTCAACATGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005731
VALIDATED
ARPC2 MISSION shRNA Lentiviral Transduction Particles
actin related protein 2/3 complex, subunit 2, 34kDa
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005731.2-1056s21c1
Sequence:GTACCGGTGCGCCTCTTCAGGTTCTTAACTCGAGTTAAGAACCTGAAGAGGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_005731.2-1189s21c1
Sequence:GTACCGGATTCCACTTGATCAACTTAATCTCGAGATTAAGTTGATCAAGTGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005731.2-411s21c1
Sequence:CCGGGCTGGCATGTTGAAGCGAAATCTCGAGATTTCGCTTCAACATGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005731.2-830s21c1
Sequence:CCGGCTACCACATCAAGTGCTCTAACTCGAGTTAGAGCACTTGATGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005731.2-311s21c1
Sequence:CCGGGTACGGGAGTTTCTTGGTAAACTCGAGTTTACCAAGAAACTCCCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005731.2-210s21c1
Sequence:CCGGTCAAATCCTAATGGAGACAAACTCGAGTTTGTCTCCATTAGGATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005731.2-281s21c1
Sequence:GTACCGGACATGGTGCTGATGAGTTATTCTCGAGAATAACTCATCAGCACCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005731.2-210s1c1
Sequence:CCGGTCAAATCCTAATGGAGACAAACTCGAGTTTGTCTCCATTAGGATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005731.2-830s1c1
Sequence:CCGGCTACCACATCAAGTGCTCTAACTCGAGTTAGAGCACTTGATGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_005731.2-311s1c1
Sequence:CCGGGTACGGGAGTTTCTTGGTAAACTCGAGTTTACCAAGAAACTCCCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005731.2-498s1c1
Sequence:CCGGGCAGTTATCCATTATAGGGATCTCGAGATCCCTATAATGGATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005731.2-411s1c1
Sequence:CCGGGCTGGCATGTTGAAGCGAAATCTCGAGATTTCGCTTCAACATGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029711
VALIDATED
ARPC2 MISSION shRNA Bacterial Glycerol Stock
actin related protein 2/3 complex, subunit 2, 34kDa
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029711.1-1022s21c1
Sequence:GTACCGGACTATCTGCACTACCACATTACTCGAGTAATGTGGTAGTGCAGATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029711.1-1062s21c1
Sequence:CCGGTCATACACGAATGCGAGCAAACTCGAGTTTGCTCGCATTCGTGTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029711.1-496s21c1
Sequence:CCGGGAGTTGTTAAAGAGAGTGTATCTCGAGATACACTCTCTTTAACAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326962    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029711.1-1351s21c1
Sequence:CCGGGACTTGATAGTTCCTAAGAATCTCGAGATTCTTAGGAACTATCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029711.1-395s21c1
Sequence:CCGGGCGTCCTTTATCATATTTCAACTCGAGTTGAAATATGATAAAGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029711.1-815s21c1
Sequence:GTACCGGTGTTCATGCAGGAGTTCAAAGCTCGAGCTTTGAACTCCTGCATGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029711
VALIDATED
ARPC2 MISSION shRNA shRNA Plasmid DNA
actin related protein 2/3 complex, subunit 2, 34kDa
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029711.1-1022s21c1
Sequence:GTACCGGACTATCTGCACTACCACATTACTCGAGTAATGTGGTAGTGCAGATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029711.1-1062s21c1
Sequence:CCGGTCATACACGAATGCGAGCAAACTCGAGTTTGCTCGCATTCGTGTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029711.1-496s21c1
Sequence:CCGGGAGTTGTTAAAGAGAGTGTATCTCGAGATACACTCTCTTTAACAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326962    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029711.1-1351s21c1
Sequence:CCGGGACTTGATAGTTCCTAAGAATCTCGAGATTCTTAGGAACTATCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029711.1-395s21c1
Sequence:CCGGGCGTCCTTTATCATATTTCAACTCGAGTTGAAATATGATAAAGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029711.1-815s21c1
Sequence:GTACCGGTGTTCATGCAGGAGTTCAAAGCTCGAGCTTTGAACTCCTGCATGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029711
VALIDATED
ARPC2 MISSION shRNA Lentiviral Transduction Particles
actin related protein 2/3 complex, subunit 2, 34kDa
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029711.1-1022s21c1
Sequence:GTACCGGACTATCTGCACTACCACATTACTCGAGTAATGTGGTAGTGCAGATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029711.1-1062s21c1
Sequence:CCGGTCATACACGAATGCGAGCAAACTCGAGTTTGCTCGCATTCGTGTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029711.1-496s21c1
Sequence:CCGGGAGTTGTTAAAGAGAGTGTATCTCGAGATACACTCTCTTTAACAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326962    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029711.1-1351s21c1
Sequence:CCGGGACTTGATAGTTCCTAAGAATCTCGAGATTCTTAGGAACTATCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029711.1-395s21c1
Sequence:CCGGGCGTCCTTTATCATATTTCAACTCGAGTTGAAATATGATAAAGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029711.1-815s21c1
Sequence:GTACCGGTGTTCATGCAGGAGTTCAAAGCTCGAGCTTTGAACTCCTGCATGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_129773
VALIDATED
ARPC2 MISSION shRNA Bacterial Glycerol Stock
actin related protein 2/3 complex, subunit 2, 34kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129773.7-529s1c1
Sequence:CCGGGAGTTGTTAAAGAGAGTGTATCTCGAGATACACTCTCTTTAACAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129773.7-1095s1c1
Sequence:CCGGTCATACACGAATGCGAGCAAACTCGAGTTTGCTCGCATTCGTGTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_129773.7-1384s1c1
Sequence:CCGGGACTTGATAGTTCCTAAGAATCTCGAGATTCTTAGGAACTATCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129773.7-590s1c1
Sequence:CCGGCTTTGCTATATGACCTGGAAACTCGAGTTTCCAGGTCATATAGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129773.7-428s1c1
Sequence:CCGGGCGTCCTTTATCATATTTCAACTCGAGTTGAAATATGATAAAGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_129773
VALIDATED
ARPC2 MISSION shRNA shRNA Plasmid DNA
actin related protein 2/3 complex, subunit 2, 34kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129773.7-529s1c1
Sequence:CCGGGAGTTGTTAAAGAGAGTGTATCTCGAGATACACTCTCTTTAACAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129773.7-1095s1c1
Sequence:CCGGTCATACACGAATGCGAGCAAACTCGAGTTTGCTCGCATTCGTGTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_129773.7-1384s1c1
Sequence:CCGGGACTTGATAGTTCCTAAGAATCTCGAGATTCTTAGGAACTATCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129773.7-590s1c1
Sequence:CCGGCTTTGCTATATGACCTGGAAACTCGAGTTTCCAGGTCATATAGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129773.7-428s1c1
Sequence:CCGGGCGTCCTTTATCATATTTCAACTCGAGTTGAAATATGATAAAGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_129773
VALIDATED
ARPC2 MISSION shRNA Lentiviral Transduction Particles
actin related protein 2/3 complex, subunit 2, 34kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129773.7-529s1c1
Sequence:CCGGGAGTTGTTAAAGAGAGTGTATCTCGAGATACACTCTCTTTAACAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129773.7-1095s1c1
Sequence:CCGGTCATACACGAATGCGAGCAAACTCGAGTTTGCTCGCATTCGTGTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_129773.7-1384s1c1
Sequence:CCGGGACTTGATAGTTCCTAAGAATCTCGAGATTCTTAGGAACTATCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129773.7-590s1c1
Sequence:CCGGCTTTGCTATATGACCTGGAAACTCGAGTTTCCAGGTCATATAGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129773.7-428s1c1
Sequence:CCGGGCGTCCTTTATCATATTTCAACTCGAGTTGAAATATGATAAAGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks