EMAIL THIS PAGE TO A FRIEND

ARPC3

actin related protein 2/3 complex, subunit 3, 21kDa

Synonyms: ARC21 p21-Arc
UniProtKB ID: O15145, O00554
Gene ID:
Human(10094) Summary: This gene encodes one of seven subunits of the human Arp2/3 protein complex. The Arp2/3 protein complex has been implicated in the control of actin polymerization in cells and has been conserved through evolution. The exact role of the protein encoded by this gene, the p21 subunit, has yet to be determined. [provided by RefSeq, Jul 2008]
Mouse(56378) actin related protein 2/3 complex, subunit 3
Rat(288669) actin related protein 2/3 complex, subunit 3
Zebrafish(415204) actin related protein 2/3 complex, subunit 3
cow(506596) actin related protein 2/3 complex, subunit 3, 21kDa
domestic cat(101098659) actin related protein 2/3 complex, subunit 3, 21kDa
dog(477474) actin related protein 2/3 complex, subunit 3, 21kDa
chicken(416837) actin related protein 2/3 complex, subunit 3, 21kDa
Thale Cress(842338) actin-related protein C3
domestic guinea pig(100727633) actin related protein 2/3 complex, subunit 3, 21kDa
naked mole-rat(101719916) actin related protein 2/3 complex, subunit 3, 21kDa
sheep(101105028) actin related protein 2/3 complex, subunit 3, 21kDa
Gene Class: Cytoskeleton
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005719 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005719 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005719 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019824 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019824 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019824 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005719 Rosetta Predictions human pricing
NM_001105933 Rosetta Predictions rat pricing
NM_019824 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005719 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214830 predicted 560
2 SASI_Hs01_00214831 predicted 498
3 SASI_Hs01_00214832 predicted 464
4 SASI_Hs01_00214833 predicted 499
5 SASI_Hs01_00214834 predicted 478
6 SASI_Hs01_00214835 predicted 208
7 SASI_Hs01_00214836 predicted 276
8 SASI_Hs01_00214837 predicted 208
9 SASI_Hs01_00214838 predicted 429
10 SASI_Hs02_00340138 predicted 471
11 SASI_Hs01_00214839 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105933 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213972 predicted 580
2 SASI_Rn02_00213973 predicted 335
3 SASI_Rn02_00213974 predicted 320
4 SASI_Rn02_00213975 predicted 521
5 SASI_Rn02_00213976 predicted 226
6 SASI_Rn02_00213977 predicted 653
7 SASI_Rn02_00213978 predicted 297
8 SASI_Rn02_00213979 predicted 308
9 SASI_Rn02_00213980 predicted 226
10 SASI_Rn02_00213981 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019824 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157594 predicted 532
2 SASI_Mm02_00325116 predicted 485
3 SASI_Mm01_00157595 predicted 293
4 SASI_Mm01_00157596 predicted 256
5 SASI_Mm01_00157598 predicted 521
6 SASI_Mm01_00157599 predicted 451
7 SASI_Mm01_00157600 predicted 226
8 SASI_Mm01_00157601 predicted 321
9 SASI_Mm01_00157602 predicted 341
10 SASI_Mm01_00157603 predicted 425
11 SASI_Mm01_00157597 predicted 261
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005719
VALIDATED
ARPC3 MISSION shRNA Bacterial Glycerol Stock
actin related protein 2/3 complex, subunit 3, 21kDa
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005719.2-159s1c1
Sequence:CCGGGCCTATCAGAAGTCAATTCAACTCGAGTTGAATTGACTTCTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005719.2-279s1c1
Sequence:CCGGTGAAGCTGATAGGACCTTGATCTCGAGATCAAGGTCCTATCAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005719.2-125s1c1
Sequence:CCGGCTGATACCAAACTCATCGGAACTCGAGTTCCGATGAGTTTGGTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005719.2-451s1c1
Sequence:CCGGCCTGCAAACAAACAGGAAGATCTCGAGATCTTCCTGTTTGTTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005719.2-228s1c1
Sequence:CCGGCATCTATTACTTCAAGGCCAACTCGAGTTGGCCTTGAAGTAATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005719.2-472s21c1
Sequence:GTACCGGGAAGTGATGAGAGCCTATTTACTCGAGTAAATAGGCTCTCATCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_005719.2-208s21c1
Sequence:CCGGACAGATATTGTGGATGAAGCCCTCGAGGGCTTCATCCACAATATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_005719.2-292s21c1
Sequence:CCGGACCTTGATATATATAACTCTCCTCGAGGAGAGTTATATATATCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005719.2-159s21c1
Sequence:CCGGGCCTATCAGAAGTCAATTCAACTCGAGTTGAATTGACTTCTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005719.2-279s21c1
Sequence:CCGGTGAAGCTGATAGGACCTTGATCTCGAGATCAAGGTCCTATCAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005719.2-125s21c1
Sequence:CCGGCTGATACCAAACTCATCGGAACTCGAGTTCCGATGAGTTTGGTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005719.2-594s21c1
Sequence:GTACCGGGTTCATGAACAAGAGTCTTTCCTCGAGGAAAGACTCTTGTTCATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005719.2-729s21c1
Sequence:GTACCGGAGAGAGAAGAGCATGTCTTTACTCGAGTAAAGACATGCTCTTCTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005719
VALIDATED
ARPC3 MISSION shRNA shRNA Plasmid DNA
actin related protein 2/3 complex, subunit 3, 21kDa
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005719.2-159s1c1
Sequence:CCGGGCCTATCAGAAGTCAATTCAACTCGAGTTGAATTGACTTCTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005719.2-279s1c1
Sequence:CCGGTGAAGCTGATAGGACCTTGATCTCGAGATCAAGGTCCTATCAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005719.2-125s1c1
Sequence:CCGGCTGATACCAAACTCATCGGAACTCGAGTTCCGATGAGTTTGGTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005719.2-451s1c1
Sequence:CCGGCCTGCAAACAAACAGGAAGATCTCGAGATCTTCCTGTTTGTTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005719.2-228s1c1
Sequence:CCGGCATCTATTACTTCAAGGCCAACTCGAGTTGGCCTTGAAGTAATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005719.2-472s21c1
Sequence:GTACCGGGAAGTGATGAGAGCCTATTTACTCGAGTAAATAGGCTCTCATCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_005719.2-208s21c1
Sequence:CCGGACAGATATTGTGGATGAAGCCCTCGAGGGCTTCATCCACAATATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_005719.2-292s21c1
Sequence:CCGGACCTTGATATATATAACTCTCCTCGAGGAGAGTTATATATATCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005719.2-159s21c1
Sequence:CCGGGCCTATCAGAAGTCAATTCAACTCGAGTTGAATTGACTTCTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005719.2-279s21c1
Sequence:CCGGTGAAGCTGATAGGACCTTGATCTCGAGATCAAGGTCCTATCAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005719.2-125s21c1
Sequence:CCGGCTGATACCAAACTCATCGGAACTCGAGTTCCGATGAGTTTGGTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005719.2-594s21c1
Sequence:GTACCGGGTTCATGAACAAGAGTCTTTCCTCGAGGAAAGACTCTTGTTCATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005719.2-729s21c1
Sequence:GTACCGGAGAGAGAAGAGCATGTCTTTACTCGAGTAAAGACATGCTCTTCTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005719
VALIDATED
ARPC3 MISSION shRNA Lentiviral Transduction Particles
actin related protein 2/3 complex, subunit 3, 21kDa
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005719.2-159s1c1
Sequence:CCGGGCCTATCAGAAGTCAATTCAACTCGAGTTGAATTGACTTCTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005719.2-279s1c1
Sequence:CCGGTGAAGCTGATAGGACCTTGATCTCGAGATCAAGGTCCTATCAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005719.2-125s1c1
Sequence:CCGGCTGATACCAAACTCATCGGAACTCGAGTTCCGATGAGTTTGGTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005719.2-451s1c1
Sequence:CCGGCCTGCAAACAAACAGGAAGATCTCGAGATCTTCCTGTTTGTTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005719.2-228s1c1
Sequence:CCGGCATCTATTACTTCAAGGCCAACTCGAGTTGGCCTTGAAGTAATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005719.2-472s21c1
Sequence:GTACCGGGAAGTGATGAGAGCCTATTTACTCGAGTAAATAGGCTCTCATCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_005719.2-208s21c1
Sequence:CCGGACAGATATTGTGGATGAAGCCCTCGAGGGCTTCATCCACAATATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_005719.2-292s21c1
Sequence:CCGGACCTTGATATATATAACTCTCCTCGAGGAGAGTTATATATATCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005719.2-159s21c1
Sequence:CCGGGCCTATCAGAAGTCAATTCAACTCGAGTTGAATTGACTTCTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005719.2-279s21c1
Sequence:CCGGTGAAGCTGATAGGACCTTGATCTCGAGATCAAGGTCCTATCAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005719.2-125s21c1
Sequence:CCGGCTGATACCAAACTCATCGGAACTCGAGTTCCGATGAGTTTGGTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005719.2-594s21c1
Sequence:GTACCGGGTTCATGAACAAGAGTCTTTCCTCGAGGAAAGACTCTTGTTCATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005719.2-729s21c1
Sequence:GTACCGGAGAGAGAAGAGCATGTCTTTACTCGAGTAAAGACATGCTCTTCTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019824
VALIDATED
ARPC3 MISSION shRNA Bacterial Glycerol Stock
actin related protein 2/3 complex, subunit 3, 21kDa
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019824.2-671s1c1
Sequence:CCGGCCTACCGTATCAAGGAGAGAACTCGAGTTCTCTCCTTGATACGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019824.2-517s1c1
Sequence:CCGGTCAGAGTGATAAACCCAGCAACTCGAGTTGCTGGGTTTATCACTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019824.2-352s1c1
Sequence:CCGGCACGCTAGGAATCACCAACTTCTCGAGAAGTTGGTGATTCCTAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019824.2-393s1c1
Sequence:CCGGGCTTTCCTCTCAACGCCATTTCTCGAGAAATGGCGTTGAGAGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019824.2-167s1c1
Sequence:CCGGGAGACCAAAGACACGGACATTCTCGAGAATGTCCGTGTCTTTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019824.3-98s21c1
Sequence:GTACCGGGACACCAAGCTCATCGGTAACCTCGAGGTTACCGATGAGCTTGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019824.3-671s21c1
Sequence:CCGGCCTACCGTATCAAGGAGAGAACTCGAGTTCTCTCCTTGATACGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019824.3-167s21c1
Sequence:CCGGGAGACCAAAGACACGGACATTCTCGAGAATGTCCGTGTCTTTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019824.3-393s21c1
Sequence:CCGGGCTTTCCTCTCAACGCCATTTCTCGAGAAATGGCGTTGAGAGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019824.3-509s21c1
Sequence:CCGGTTTGACCCTCAGAGTGATAAACTCGAGTTTATCACTCTGAGGGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019824.3-429s21c1
Sequence:GTACCGGGCAAACAGGAGGACGAGATGACTCGAGTCATCTCGTCCTCCTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019824.3-191s21c1
Sequence:GTACCGGGATGAAGCCATCTACTACTTCCTCGAGGAAGTAGTAGATGGCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019824
VALIDATED
ARPC3 MISSION shRNA shRNA Plasmid DNA
actin related protein 2/3 complex, subunit 3, 21kDa
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019824.2-671s1c1
Sequence:CCGGCCTACCGTATCAAGGAGAGAACTCGAGTTCTCTCCTTGATACGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019824.2-517s1c1
Sequence:CCGGTCAGAGTGATAAACCCAGCAACTCGAGTTGCTGGGTTTATCACTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019824.2-352s1c1
Sequence:CCGGCACGCTAGGAATCACCAACTTCTCGAGAAGTTGGTGATTCCTAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019824.2-393s1c1
Sequence:CCGGGCTTTCCTCTCAACGCCATTTCTCGAGAAATGGCGTTGAGAGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019824.2-167s1c1
Sequence:CCGGGAGACCAAAGACACGGACATTCTCGAGAATGTCCGTGTCTTTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019824.3-98s21c1
Sequence:GTACCGGGACACCAAGCTCATCGGTAACCTCGAGGTTACCGATGAGCTTGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019824.3-671s21c1
Sequence:CCGGCCTACCGTATCAAGGAGAGAACTCGAGTTCTCTCCTTGATACGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019824.3-167s21c1
Sequence:CCGGGAGACCAAAGACACGGACATTCTCGAGAATGTCCGTGTCTTTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019824.3-393s21c1
Sequence:CCGGGCTTTCCTCTCAACGCCATTTCTCGAGAAATGGCGTTGAGAGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019824.3-509s21c1
Sequence:CCGGTTTGACCCTCAGAGTGATAAACTCGAGTTTATCACTCTGAGGGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019824.3-429s21c1
Sequence:GTACCGGGCAAACAGGAGGACGAGATGACTCGAGTCATCTCGTCCTCCTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019824.3-191s21c1
Sequence:GTACCGGGATGAAGCCATCTACTACTTCCTCGAGGAAGTAGTAGATGGCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019824
VALIDATED
ARPC3 MISSION shRNA Lentiviral Transduction Particles
actin related protein 2/3 complex, subunit 3, 21kDa
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019824.2-671s1c1
Sequence:CCGGCCTACCGTATCAAGGAGAGAACTCGAGTTCTCTCCTTGATACGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019824.2-517s1c1
Sequence:CCGGTCAGAGTGATAAACCCAGCAACTCGAGTTGCTGGGTTTATCACTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019824.2-352s1c1
Sequence:CCGGCACGCTAGGAATCACCAACTTCTCGAGAAGTTGGTGATTCCTAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019824.2-393s1c1
Sequence:CCGGGCTTTCCTCTCAACGCCATTTCTCGAGAAATGGCGTTGAGAGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019824.2-167s1c1
Sequence:CCGGGAGACCAAAGACACGGACATTCTCGAGAATGTCCGTGTCTTTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019824.3-98s21c1
Sequence:GTACCGGGACACCAAGCTCATCGGTAACCTCGAGGTTACCGATGAGCTTGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019824.3-671s21c1
Sequence:CCGGCCTACCGTATCAAGGAGAGAACTCGAGTTCTCTCCTTGATACGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019824.3-167s21c1
Sequence:CCGGGAGACCAAAGACACGGACATTCTCGAGAATGTCCGTGTCTTTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019824.3-393s21c1
Sequence:CCGGGCTTTCCTCTCAACGCCATTTCTCGAGAAATGGCGTTGAGAGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019824.3-509s21c1
Sequence:CCGGTTTGACCCTCAGAGTGATAAACTCGAGTTTATCACTCTGAGGGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019824.3-429s21c1
Sequence:GTACCGGGCAAACAGGAGGACGAGATGACTCGAGTCATCTCGTCCTCCTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019824.3-191s21c1
Sequence:GTACCGGGATGAAGCCATCTACTACTTCCTCGAGGAAGTAGTAGATGGCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks