EMAIL THIS PAGE TO A FRIEND

ARPC4

actin related protein 2/3 complex, subunit 4, 20kDa

126 Gene Product Result for
Synonyms: ARC20 P20-ARC
Gene ID:
Human(10093) Summary: This gene encodes one of seven subunits of the human Arp2/3 protein complex. This complex controls actin polymerization in cells and has been conserved throughout eukaryotic evolution. This gene encodes the p20 subunit, which is necessary for actin nucleation and high-affinity binding to F-actin. Alternative splicing results in multiple transcript variants. Naturally occurring read-through transcription exists between this gene and the downstream tubulin tyrosine ligase-like family, member 3 (TTLL3), which results in the production of a fusion protein. [provided by RefSeq, Nov 2010]
Mouse(68089) actin related protein 2/3 complex, subunit 4
Rat(297518) actin related protein 2/3 complex, subunit 4
Zebrafish(114456) actin related protein 2/3 complex, subunit 4
dog(476540) actin related protein 2/3 complex, subunit 4, 20kDa
cow(539459) actin related protein 2/3 complex, subunit 4, 20kDa
domestic cat(101084688) actin related protein 2/3 complex, subunit 4, 20kDa
fruit fly(33864) Actin-related protein 2/3 complex, subunit 4
chicken(416051) actin related protein 2/3 complex, subunit 4, 20kDa
Thale Cress(3770404) actin related protein 2/3 complex, subunit 4
domestic guinea pig(100718918) actin related protein 2/3 complex, subunit 4, 20kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026552 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026552 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026552 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005718 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005718 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005718 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU147741 MISSION® esiRNA esiRNA targeting mouse Arpc4 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024959 Rosetta Predictions human pricing
NM_001024960 Rosetta Predictions human pricing
NM_005718 Rosetta Predictions human pricing
NM_001106615 Rosetta Predictions rat pricing
NM_026552 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024959 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226283 predicted 633
2 SASI_Hs02_00307304 predicted 525
3 SASI_Hs01_00226284 predicted 637
4 SASI_Hs01_00226286 predicted 597
5 SASI_Hs01_00226287 predicted 445
6 SASI_Hs01_00226288 predicted 556
7 SASI_Hs01_00226289 predicted 581
8 SASI_Hs02_00307305 predicted 492
9 SASI_Hs01_00226292 predicted 1004
10 SASI_Hs01_00226285 predicted 629
11 SASI_Hs01_00226290 predicted 599
12 SASI_Hs01_00226291 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024960 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075592 predicted 482
2 SASI_Hs02_00307306 predicted 373
3 SASI_Hs01_00075593 predicted 492
4 SASI_Hs01_00075595 predicted 449
5 SASI_Hs01_00075596 predicted 305
6 SASI_Hs01_00075597 predicted 407
7 SASI_Hs01_00075598 predicted 431
8 SASI_Hs02_00307307 predicted 343
9 SASI_Hs01_00075601 predicted 857
10 SASI_Hs01_00075594 predicted 483
11 SASI_Hs01_00075599 predicted 453
12 SASI_Hs01_00075600 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196611 predicted 1055
2 SASI_Hs01_00196612 predicted 779
3 SASI_Hs01_00196613 predicted 1047
4 SASI_Hs01_00196614 predicted 834
5 SASI_Hs01_00196615 predicted 1017
6 SASI_Hs01_00196616 predicted 871
7 SASI_Hs01_00196617 predicted 975
8 SASI_Hs01_00196618 predicted 996
9 SASI_Hs02_00340137 predicted 945
10 SASI_Hs01_00196619 predicted 914
11 SASI_Hs01_00196620 predicted 1037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106615 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220688 predicted 557
2 SASI_Rn02_00220689 predicted 1805
3 SASI_Rn02_00220690 predicted 1760
4 SASI_Rn02_00220691 predicted 1956
5 SASI_Rn02_00220692 predicted 1945
6 SASI_Rn02_00220693 predicted 1756
7 SASI_Rn02_00220694 predicted 2008
8 SASI_Rn02_00220695 predicted 1874
9 SASI_Rn02_00220696 predicted 1847
10 SASI_Rn02_00220697 predicted 1783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026552 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330480 predicted 294
2 SASI_Mm01_00155527 predicted 312
3 SASI_Mm01_00155529 predicted 271
4 SASI_Mm01_00155530 predicted 205
5 SASI_Mm02_00330481 predicted 573
6 SASI_Mm01_00155531 predicted 215
7 SASI_Mm01_00155532 predicted 416
8 SASI_Mm01_00155533 predicted 484
9 SASI_Mm01_00155534 predicted 217
10 SASI_Mm01_00155535 predicted 419
11 SASI_Mm01_00155528 predicted 207
12 SASI_Mm01_00155536 predicted 323
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026552
VALIDATED
ARPC4 MISSION shRNA Bacterial Glycerol Stock
actin related protein 2/3 complex, subunit 4, 20kDa
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026552.2-318s21c1
Sequence:GTACCGGTGTGAAGCAGGCCGATGAAATCTCGAGATTTCATCGGCCTGCTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026552.2-380s21c1
Sequence:GTACCGGTGCGAGCAGAGAACTTCTTTACTCGAGTAAAGAAGTTCTCTGCTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026552.2-458s21c1
Sequence:GTACCGGACACGGAGCAGATGTACAAACCTCGAGGTTTGTACATCTGCTCCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026552.2-217s21c1
Sequence:CCGGAGTAGCAAAGAACTGCTATTACTCGAGTAATAGCAGTTCTTTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026552.2-354s21c1
Sequence:CCGGCCATAAATTCATGCGCTTCATCTCGAGATGAAGCGCATGAATTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026552.2-1107s21c1
Sequence:CCGGGCTGTCTTACAAGCCTCCTTACTCGAGTAAGGAGGCTTGTAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026552.2-410s21c1
Sequence:CCGGGGAAACCTGTGGAGGGATATGCTCGAGCATATCCCTCCACAGGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026552.2-536s21c1
Sequence:GTACCGGAGATGAAGCTGTCGGTCAATGCTCGAGCATTGACCGACAGCTTCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026552.1-1108s1c1
Sequence:CCGGGCTGTCTTACAAGCCTCCTTACTCGAGTAAGGAGGCTTGTAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026552.1-575s1c1
Sequence:CCGGGCTGAGGAGTTCCTCAAGAATCTCGAGATTCTTGAGGAACTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026552.1-218s1c1
Sequence:CCGGAGTAGCAAAGAACTGCTATTACTCGAGTAATAGCAGTTCTTTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026552.1-355s1c1
Sequence:CCGGCCATAAATTCATGCGCTTCATCTCGAGATGAAGCGCATGAATTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026552.1-325s1c1
Sequence:CCGGGCAGGCCGATGAAATTGAGAACTCGAGTTCTCAATTTCATCGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026552
VALIDATED
ARPC4 MISSION shRNA shRNA Plasmid DNA
actin related protein 2/3 complex, subunit 4, 20kDa
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026552.2-318s21c1
Sequence:GTACCGGTGTGAAGCAGGCCGATGAAATCTCGAGATTTCATCGGCCTGCTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026552.2-380s21c1
Sequence:GTACCGGTGCGAGCAGAGAACTTCTTTACTCGAGTAAAGAAGTTCTCTGCTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026552.2-458s21c1
Sequence:GTACCGGACACGGAGCAGATGTACAAACCTCGAGGTTTGTACATCTGCTCCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026552.2-217s21c1
Sequence:CCGGAGTAGCAAAGAACTGCTATTACTCGAGTAATAGCAGTTCTTTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026552.2-354s21c1
Sequence:CCGGCCATAAATTCATGCGCTTCATCTCGAGATGAAGCGCATGAATTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026552.2-1107s21c1
Sequence:CCGGGCTGTCTTACAAGCCTCCTTACTCGAGTAAGGAGGCTTGTAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026552.2-410s21c1
Sequence:CCGGGGAAACCTGTGGAGGGATATGCTCGAGCATATCCCTCCACAGGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026552.2-536s21c1
Sequence:GTACCGGAGATGAAGCTGTCGGTCAATGCTCGAGCATTGACCGACAGCTTCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026552.1-1108s1c1
Sequence:CCGGGCTGTCTTACAAGCCTCCTTACTCGAGTAAGGAGGCTTGTAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026552.1-575s1c1
Sequence:CCGGGCTGAGGAGTTCCTCAAGAATCTCGAGATTCTTGAGGAACTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026552.1-218s1c1
Sequence:CCGGAGTAGCAAAGAACTGCTATTACTCGAGTAATAGCAGTTCTTTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026552.1-355s1c1
Sequence:CCGGCCATAAATTCATGCGCTTCATCTCGAGATGAAGCGCATGAATTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026552.1-325s1c1
Sequence:CCGGGCAGGCCGATGAAATTGAGAACTCGAGTTCTCAATTTCATCGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026552
VALIDATED
ARPC4 MISSION shRNA Lentiviral Transduction Particles
actin related protein 2/3 complex, subunit 4, 20kDa
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026552.2-318s21c1
Sequence:GTACCGGTGTGAAGCAGGCCGATGAAATCTCGAGATTTCATCGGCCTGCTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026552.2-380s21c1
Sequence:GTACCGGTGCGAGCAGAGAACTTCTTTACTCGAGTAAAGAAGTTCTCTGCTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026552.2-458s21c1
Sequence:GTACCGGACACGGAGCAGATGTACAAACCTCGAGGTTTGTACATCTGCTCCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026552.2-217s21c1
Sequence:CCGGAGTAGCAAAGAACTGCTATTACTCGAGTAATAGCAGTTCTTTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026552.2-354s21c1
Sequence:CCGGCCATAAATTCATGCGCTTCATCTCGAGATGAAGCGCATGAATTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026552.2-1107s21c1
Sequence:CCGGGCTGTCTTACAAGCCTCCTTACTCGAGTAAGGAGGCTTGTAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026552.2-410s21c1
Sequence:CCGGGGAAACCTGTGGAGGGATATGCTCGAGCATATCCCTCCACAGGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026552.2-536s21c1
Sequence:GTACCGGAGATGAAGCTGTCGGTCAATGCTCGAGCATTGACCGACAGCTTCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026552.1-1108s1c1
Sequence:CCGGGCTGTCTTACAAGCCTCCTTACTCGAGTAAGGAGGCTTGTAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026552.1-575s1c1
Sequence:CCGGGCTGAGGAGTTCCTCAAGAATCTCGAGATTCTTGAGGAACTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026552.1-218s1c1
Sequence:CCGGAGTAGCAAAGAACTGCTATTACTCGAGTAATAGCAGTTCTTTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026552.1-355s1c1
Sequence:CCGGCCATAAATTCATGCGCTTCATCTCGAGATGAAGCGCATGAATTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026552.1-325s1c1
Sequence:CCGGGCAGGCCGATGAAATTGAGAACTCGAGTTCTCAATTTCATCGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005718
VALIDATED
ARPC4 MISSION shRNA Bacterial Glycerol Stock
actin related protein 2/3 complex, subunit 4, 20kDa
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005718.3-985s21c1
Sequence:GTACCGGATCCACTTCATGGAGGAGATTCTCGAGAATCTCCTCCATGAAGTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005718.3-1485s21c1
Sequence:GTACCGGGAGCCAGAAGGCGACTTATTTCTCGAGAAATAAGTCGCCTTCTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005718.3-767s21c1
Sequence:GTACCGGTTGAGGGCTCCATCAACTCTGCTCGAGCAGAGTTGATGGAGCCCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005718.3-672s21c1
Sequence:GTACCGGACGACACAACAAGCCGGAAGTCTCGAGACTTCCGGCTTGTTGTGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005718.3-1122s21c1
Sequence:GTACCGGACTACCCATGTCTCCACGAAGCTCGAGCTTCGTGGAGACATGGGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005718.3-1022s21c1
Sequence:GTACCGGAGATGAAGCTGTCAGTCAATGCTCGAGCATTGACTGACAGCTTCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005718.3-732s21c1
Sequence:GTACCGGGACCATCAGCAGGAATGAGAACTCGAGTTCTCATTCCTGCTGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005718.3-1060s21c1
Sequence:GTACCGGGCTGAAGAGTTCCTTAAGAATCTCGAGATTCTTAAGGAACTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_005718.3-923s21c1
Sequence:GTACCGGGCTTTCTGATCACCAACTTCCCTCGAGGGAAGTTGGTGATCAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005718.2-307s1c1
Sequence:CCGGGCTGATGAGATCGAGAAGATTCTCGAGAATCTTCTCGATCTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005718.2-196s1c1
Sequence:CCGGAGTAGCAAAGAGCTCCTGTTACTCGAGTAACAGGAGCTCTTTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005718.2-360s1c1
Sequence:CCGGGCGAGCAGAGAACTTCTTTATCTCGAGATAAAGAAGTTCTCTGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005718.2-333s1c1
Sequence:CCGGCCACAAGTTCATGCGCTTCATCTCGAGATGAAGCGCATGAACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005718.2-453s1c1
Sequence:CCGGCAAACACAAGTTGGTGGACTTCTCGAGAAGTCCACCAACTTGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005718
VALIDATED
ARPC4 MISSION shRNA shRNA Plasmid DNA
actin related protein 2/3 complex, subunit 4, 20kDa
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005718.3-985s21c1
Sequence:GTACCGGATCCACTTCATGGAGGAGATTCTCGAGAATCTCCTCCATGAAGTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005718.3-1485s21c1
Sequence:GTACCGGGAGCCAGAAGGCGACTTATTTCTCGAGAAATAAGTCGCCTTCTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005718.3-767s21c1
Sequence:GTACCGGTTGAGGGCTCCATCAACTCTGCTCGAGCAGAGTTGATGGAGCCCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005718.3-672s21c1
Sequence:GTACCGGACGACACAACAAGCCGGAAGTCTCGAGACTTCCGGCTTGTTGTGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005718.3-1122s21c1
Sequence:GTACCGGACTACCCATGTCTCCACGAAGCTCGAGCTTCGTGGAGACATGGGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005718.3-1022s21c1
Sequence:GTACCGGAGATGAAGCTGTCAGTCAATGCTCGAGCATTGACTGACAGCTTCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005718.3-732s21c1
Sequence:GTACCGGGACCATCAGCAGGAATGAGAACTCGAGTTCTCATTCCTGCTGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005718.3-1060s21c1
Sequence:GTACCGGGCTGAAGAGTTCCTTAAGAATCTCGAGATTCTTAAGGAACTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_005718.3-923s21c1
Sequence:GTACCGGGCTTTCTGATCACCAACTTCCCTCGAGGGAAGTTGGTGATCAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005718.2-307s1c1
Sequence:CCGGGCTGATGAGATCGAGAAGATTCTCGAGAATCTTCTCGATCTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005718.2-196s1c1
Sequence:CCGGAGTAGCAAAGAGCTCCTGTTACTCGAGTAACAGGAGCTCTTTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005718.2-360s1c1
Sequence:CCGGGCGAGCAGAGAACTTCTTTATCTCGAGATAAAGAAGTTCTCTGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005718.2-333s1c1
Sequence:CCGGCCACAAGTTCATGCGCTTCATCTCGAGATGAAGCGCATGAACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005718.2-453s1c1
Sequence:CCGGCAAACACAAGTTGGTGGACTTCTCGAGAAGTCCACCAACTTGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005718
VALIDATED
ARPC4 MISSION shRNA Lentiviral Transduction Particles
actin related protein 2/3 complex, subunit 4, 20kDa
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005718.3-985s21c1
Sequence:GTACCGGATCCACTTCATGGAGGAGATTCTCGAGAATCTCCTCCATGAAGTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005718.3-1485s21c1
Sequence:GTACCGGGAGCCAGAAGGCGACTTATTTCTCGAGAAATAAGTCGCCTTCTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005718.3-767s21c1
Sequence:GTACCGGTTGAGGGCTCCATCAACTCTGCTCGAGCAGAGTTGATGGAGCCCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005718.3-672s21c1
Sequence:GTACCGGACGACACAACAAGCCGGAAGTCTCGAGACTTCCGGCTTGTTGTGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005718.3-1122s21c1
Sequence:GTACCGGACTACCCATGTCTCCACGAAGCTCGAGCTTCGTGGAGACATGGGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005718.3-1022s21c1
Sequence:GTACCGGAGATGAAGCTGTCAGTCAATGCTCGAGCATTGACTGACAGCTTCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005718.3-732s21c1
Sequence:GTACCGGGACCATCAGCAGGAATGAGAACTCGAGTTCTCATTCCTGCTGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005718.3-1060s21c1
Sequence:GTACCGGGCTGAAGAGTTCCTTAAGAATCTCGAGATTCTTAAGGAACTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_005718.3-923s21c1
Sequence:GTACCGGGCTTTCTGATCACCAACTTCCCTCGAGGGAAGTTGGTGATCAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005718.2-307s1c1
Sequence:CCGGGCTGATGAGATCGAGAAGATTCTCGAGAATCTTCTCGATCTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005718.2-196s1c1
Sequence:CCGGAGTAGCAAAGAGCTCCTGTTACTCGAGTAACAGGAGCTCTTTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005718.2-360s1c1
Sequence:CCGGGCGAGCAGAGAACTTCTTTATCTCGAGATAAAGAAGTTCTCTGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005718.2-333s1c1
Sequence:CCGGCCACAAGTTCATGCGCTTCATCTCGAGATGAAGCGCATGAACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005718.2-453s1c1
Sequence:CCGGCAAACACAAGTTGGTGGACTTCTCGAGAAGTCCACCAACTTGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks