EMAIL THIS PAGE TO A FRIEND

ARPC5

actin related protein 2/3 complex, subunit 5, 16kDa

148 Gene Product Result for
Synonyms: ARC16 dJ127C7.3 p16-Arc
UniProtKB ID: O15511, A6NEC4, Q6PG42
Gene ID:
Human(10092) Summary: This gene encodes one of seven subunits of the human Arp2/3 protein complex. The Arp2/3 protein complex has been implicated in the control of actin polymerization in cells and has been conserved through evolution. The exact role of the protein encoded by this gene, the p16 subunit, has yet to be determined. Alternatively spliced transcript variants encoding different isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Mouse(67771) actin related protein 2/3 complex, subunit 5
Rat(360854) actin related protein 2/3 complex, subunit 5
fruit fly(33444) Actin-related protein 2/3 complex, subunit 5
chicken(429075) actin related protein 2/3 complex, subunit 5, 16kDa
dog(480037) actin related protein 2/3 complex, subunit 5, 16kDa
cow(614345) actin related protein 2/3 complex, subunit 5, 16kDa
domestic cat(101088207) actin related protein 2/3 complex, subunit 5, 16kDa
domestic guinea pig(100731671) actin related protein 2/3 complex, subunit 5, 16kDa
naked mole-rat(101715533) actin related protein 2/3 complex, subunit 5, 16kDa
sheep(101106701) actin related protein 2/3 complex, subunit 5, 16kDa
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026369 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026369 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026369 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005717 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005717 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005717 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005717 Rosetta Predictions human pricing
NM_001025717 Rosetta Predictions rat pricing
NM_026369 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066078 predicted 495
2 SASI_Hs01_00066079 predicted 678
3 SASI_Hs01_00066080 predicted 469
4 SASI_Hs01_00066081 predicted 218
5 SASI_Hs01_00066082 predicted 414
6 SASI_Hs01_00066077 predicted 233
7 SASI_Hs01_00066083 predicted 537
8 SASI_Hs01_00066084 predicted 611
9 SASI_Hs01_00066085 predicted 614
10 SASI_Hs01_00066086 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025717 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080104 predicted 410
2 SASI_Rn01_00080105 predicted 750
3 SASI_Rn02_00203338 predicted 730
4 SASI_Rn01_00080107 predicted 307
5 SASI_Rn01_00080108 predicted 1016
6 SASI_Rn01_00080109 predicted 841
7 SASI_Rn02_00203339 predicted 796
8 SASI_Rn01_00080111 predicted 383
9 SASI_Rn01_00080112 predicted 852
10 SASI_Rn01_00080113 predicted 395
11 SASI_Rn01_00080106 predicted 305
12 SASI_Rn01_00080110 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026369 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330096 predicted 376
2 SASI_Mm02_00330097 predicted 350
3 SASI_Mm01_00093514 predicted 822
4 SASI_Mm02_00330098 predicted 302
5 SASI_Mm01_00093515 predicted 759
6 SASI_Mm01_00093516 predicted 740
7 SASI_Mm01_00093517 predicted 944
8 SASI_Mm01_00093518 predicted 860
9 SASI_Mm01_00093519 predicted 744
10 SASI_Mm01_00093520 predicted 292
11 SASI_Mm01_00093513 predicted 939
12 SASI_Mm01_00093521 predicted 790
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026369
VALIDATED
ARPC5 MISSION shRNA Bacterial Glycerol Stock
actin related protein 2/3 complex, subunit 5, 16kDa
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026369.1-750s1c1
Sequence:CCGGCCCTTTCATAACCATGTCAATCTCGAGATTGACATGGTTATGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026369.1-203s1c1
Sequence:CCGGCTCGTGCCTACGGCAAGGAAACTCGAGTTTCCTTGCCGTAGGCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026369.1-304s1c1
Sequence:CCGGGCATCGTCTTGAAGGTGCTTACTCGAGTAAGCACCTTCAAGACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026369.1-305s1c1
Sequence:CCGGCATCGTCTTGAAGGTGCTTATCTCGAGATAAGCACCTTCAAGACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026369.1-119s1c1
Sequence:CCGGCGTGGACGAATATGACGAGAACTCGAGTTCTCGTCATATTCGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026369.2-1085s21c1
Sequence:GTACCGGGGACCACACTTCCCTTATTTACTCGAGTAAATAAGGGAAGTGTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026369.2-370s21c1
Sequence:GTACCGGCCTATTAACACAAAGAGCCAGCTCGAGCTGGCTCTTTGTGTTAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026369.2-246s21c1
Sequence:GTACCGGGAACAAGTTCGTGGACGAGGACTCGAGTCCTCGTCCACGAACTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026369.2-493s21c1
Sequence:CCGGGACCTCCTAATGAAGTATATTCTCGAGAATATACTTCATTAGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026369.2-221s21c1
Sequence:CCGGAGGTGGACGTGGACGAATATGCTCGAGCATATTCGTCCACGTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026369.2-415s21c1
Sequence:CCGGATCGTCTTGAAGGTGCTTATCCTCGAGGATAAGCACCTTCAAGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026369.2-465s21c1
Sequence:CCGGAGTGCAGTCTCTGGACAAGAACTCGAGTTCTTGTCCAGAGACTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026369.2-1052s21c1
Sequence:CCGGTGAGAGACTGGCAGCTATTAACTCGAGTTAATAGCTGCCAGTCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026369.2-930s21c1
Sequence:GTACCGGTAACTCTGTTGCCTGGTTTAACTCGAGTTAAACCAGGCAACAGAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026369.2-317s21c1
Sequence:GTACCGGGCCTACGGCAAGGAAACATGACTCGAGTCATGTTTCCTTGCCGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026369
VALIDATED
ARPC5 MISSION shRNA shRNA Plasmid DNA
actin related protein 2/3 complex, subunit 5, 16kDa
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026369.1-750s1c1
Sequence:CCGGCCCTTTCATAACCATGTCAATCTCGAGATTGACATGGTTATGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026369.1-203s1c1
Sequence:CCGGCTCGTGCCTACGGCAAGGAAACTCGAGTTTCCTTGCCGTAGGCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026369.1-304s1c1
Sequence:CCGGGCATCGTCTTGAAGGTGCTTACTCGAGTAAGCACCTTCAAGACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026369.1-305s1c1
Sequence:CCGGCATCGTCTTGAAGGTGCTTATCTCGAGATAAGCACCTTCAAGACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026369.1-119s1c1
Sequence:CCGGCGTGGACGAATATGACGAGAACTCGAGTTCTCGTCATATTCGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026369.2-1085s21c1
Sequence:GTACCGGGGACCACACTTCCCTTATTTACTCGAGTAAATAAGGGAAGTGTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026369.2-370s21c1
Sequence:GTACCGGCCTATTAACACAAAGAGCCAGCTCGAGCTGGCTCTTTGTGTTAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026369.2-246s21c1
Sequence:GTACCGGGAACAAGTTCGTGGACGAGGACTCGAGTCCTCGTCCACGAACTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026369.2-493s21c1
Sequence:CCGGGACCTCCTAATGAAGTATATTCTCGAGAATATACTTCATTAGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026369.2-221s21c1
Sequence:CCGGAGGTGGACGTGGACGAATATGCTCGAGCATATTCGTCCACGTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026369.2-415s21c1
Sequence:CCGGATCGTCTTGAAGGTGCTTATCCTCGAGGATAAGCACCTTCAAGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026369.2-465s21c1
Sequence:CCGGAGTGCAGTCTCTGGACAAGAACTCGAGTTCTTGTCCAGAGACTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026369.2-1052s21c1
Sequence:CCGGTGAGAGACTGGCAGCTATTAACTCGAGTTAATAGCTGCCAGTCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026369.2-930s21c1
Sequence:GTACCGGTAACTCTGTTGCCTGGTTTAACTCGAGTTAAACCAGGCAACAGAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026369.2-317s21c1
Sequence:GTACCGGGCCTACGGCAAGGAAACATGACTCGAGTCATGTTTCCTTGCCGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026369
VALIDATED
ARPC5 MISSION shRNA Lentiviral Transduction Particles
actin related protein 2/3 complex, subunit 5, 16kDa
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026369.1-750s1c1
Sequence:CCGGCCCTTTCATAACCATGTCAATCTCGAGATTGACATGGTTATGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026369.1-203s1c1
Sequence:CCGGCTCGTGCCTACGGCAAGGAAACTCGAGTTTCCTTGCCGTAGGCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026369.1-304s1c1
Sequence:CCGGGCATCGTCTTGAAGGTGCTTACTCGAGTAAGCACCTTCAAGACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026369.1-305s1c1
Sequence:CCGGCATCGTCTTGAAGGTGCTTATCTCGAGATAAGCACCTTCAAGACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026369.1-119s1c1
Sequence:CCGGCGTGGACGAATATGACGAGAACTCGAGTTCTCGTCATATTCGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026369.2-1085s21c1
Sequence:GTACCGGGGACCACACTTCCCTTATTTACTCGAGTAAATAAGGGAAGTGTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026369.2-370s21c1
Sequence:GTACCGGCCTATTAACACAAAGAGCCAGCTCGAGCTGGCTCTTTGTGTTAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026369.2-246s21c1
Sequence:GTACCGGGAACAAGTTCGTGGACGAGGACTCGAGTCCTCGTCCACGAACTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026369.2-493s21c1
Sequence:CCGGGACCTCCTAATGAAGTATATTCTCGAGAATATACTTCATTAGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026369.2-221s21c1
Sequence:CCGGAGGTGGACGTGGACGAATATGCTCGAGCATATTCGTCCACGTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026369.2-415s21c1
Sequence:CCGGATCGTCTTGAAGGTGCTTATCCTCGAGGATAAGCACCTTCAAGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026369.2-465s21c1
Sequence:CCGGAGTGCAGTCTCTGGACAAGAACTCGAGTTCTTGTCCAGAGACTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026369.2-1052s21c1
Sequence:CCGGTGAGAGACTGGCAGCTATTAACTCGAGTTAATAGCTGCCAGTCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026369.2-930s21c1
Sequence:GTACCGGTAACTCTGTTGCCTGGTTTAACTCGAGTTAAACCAGGCAACAGAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026369.2-317s21c1
Sequence:GTACCGGGCCTACGGCAAGGAAACATGACTCGAGTCATGTTTCCTTGCCGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005717
VALIDATED
ARPC5 MISSION shRNA Bacterial Glycerol Stock
actin related protein 2/3 complex, subunit 5, 16kDa
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005717.2-541s1c1
Sequence:CCGGCGTCTGACAATAGCAGTGCTACTCGAGTAGCACTGCTATTGTCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_005717.2-422s1c1
Sequence:CCGGCATTGTCTTGAAGGTGCTCATCTCGAGATGAGCACCTTCAAGACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_005717.2-474s1c1
Sequence:CCGGGTTCAATCTCTGGACAAGAATCTCGAGATTCTTGTCCAGAGATTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005717.2-236s1c1
Sequence:CCGGCGTGGATGAATATGACGAGAACTCGAGTTCTCGTCATATTCATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005717.2-553s1c1
Sequence:CCGGGCAGTGCTATGTTACTGCAATCTCGAGATTGCAGTAACATAGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_005717.2-605s21c1
Sequence:GTACCGGAGGGTCCATTGTTCGTGTCTTCTCGAGAAGACACGAACAATGGACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005717.2-532s21c1
Sequence:GTACCGGTTGAGAGCCCGTCTGACAATACTCGAGTATTGTCAGACGGGCTCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005717.2-647s21c1
Sequence:GTACCGGGTCTGGCAGGAAGTGGATTATCTCGAGATAATCCACTTCCTGCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005717.2-554s21c1
Sequence:GTACCGGCAGTGCTATGTTACTGCAATGCTCGAGCATTGCAGTAACATAGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005717.2-422s21c1
Sequence:CCGGCATTGTCTTGAAGGTGCTCATCTCGAGATGAGCACCTTCAAGACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005717.2-474s21c1
Sequence:CCGGGTTCAATCTCTGGACAAGAATCTCGAGATTCTTGTCCAGAGATTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005717.2-236s21c1
Sequence:CCGGCGTGGATGAATATGACGAGAACTCGAGTTCTCGTCATATTCATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005717.2-1077s21c1
Sequence:CCGGTGAGAGACTGGCAGCTATTAACTCGAGTTAATAGCTGCCAGTCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_005717.2-501s21c1
Sequence:CCGGGATCTCCTAATGAAGTATATTCTCGAGAATATACTTCATTAGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005717
VALIDATED
ARPC5 MISSION shRNA shRNA Plasmid DNA
actin related protein 2/3 complex, subunit 5, 16kDa
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005717.2-541s1c1
Sequence:CCGGCGTCTGACAATAGCAGTGCTACTCGAGTAGCACTGCTATTGTCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_005717.2-422s1c1
Sequence:CCGGCATTGTCTTGAAGGTGCTCATCTCGAGATGAGCACCTTCAAGACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_005717.2-474s1c1
Sequence:CCGGGTTCAATCTCTGGACAAGAATCTCGAGATTCTTGTCCAGAGATTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005717.2-236s1c1
Sequence:CCGGCGTGGATGAATATGACGAGAACTCGAGTTCTCGTCATATTCATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005717.2-553s1c1
Sequence:CCGGGCAGTGCTATGTTACTGCAATCTCGAGATTGCAGTAACATAGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_005717.2-605s21c1
Sequence:GTACCGGAGGGTCCATTGTTCGTGTCTTCTCGAGAAGACACGAACAATGGACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005717.2-532s21c1
Sequence:GTACCGGTTGAGAGCCCGTCTGACAATACTCGAGTATTGTCAGACGGGCTCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005717.2-647s21c1
Sequence:GTACCGGGTCTGGCAGGAAGTGGATTATCTCGAGATAATCCACTTCCTGCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005717.2-554s21c1
Sequence:GTACCGGCAGTGCTATGTTACTGCAATGCTCGAGCATTGCAGTAACATAGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005717.2-422s21c1
Sequence:CCGGCATTGTCTTGAAGGTGCTCATCTCGAGATGAGCACCTTCAAGACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005717.2-474s21c1
Sequence:CCGGGTTCAATCTCTGGACAAGAATCTCGAGATTCTTGTCCAGAGATTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005717.2-236s21c1
Sequence:CCGGCGTGGATGAATATGACGAGAACTCGAGTTCTCGTCATATTCATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005717.2-1077s21c1
Sequence:CCGGTGAGAGACTGGCAGCTATTAACTCGAGTTAATAGCTGCCAGTCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_005717.2-501s21c1
Sequence:CCGGGATCTCCTAATGAAGTATATTCTCGAGAATATACTTCATTAGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005717
VALIDATED
ARPC5 MISSION shRNA Lentiviral Transduction Particles
actin related protein 2/3 complex, subunit 5, 16kDa
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005717.2-541s1c1
Sequence:CCGGCGTCTGACAATAGCAGTGCTACTCGAGTAGCACTGCTATTGTCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_005717.2-422s1c1
Sequence:CCGGCATTGTCTTGAAGGTGCTCATCTCGAGATGAGCACCTTCAAGACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_005717.2-474s1c1
Sequence:CCGGGTTCAATCTCTGGACAAGAATCTCGAGATTCTTGTCCAGAGATTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005717.2-236s1c1
Sequence:CCGGCGTGGATGAATATGACGAGAACTCGAGTTCTCGTCATATTCATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005717.2-553s1c1
Sequence:CCGGGCAGTGCTATGTTACTGCAATCTCGAGATTGCAGTAACATAGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_005717.2-605s21c1
Sequence:GTACCGGAGGGTCCATTGTTCGTGTCTTCTCGAGAAGACACGAACAATGGACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005717.2-532s21c1
Sequence:GTACCGGTTGAGAGCCCGTCTGACAATACTCGAGTATTGTCAGACGGGCTCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005717.2-647s21c1
Sequence:GTACCGGGTCTGGCAGGAAGTGGATTATCTCGAGATAATCCACTTCCTGCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005717.2-554s21c1
Sequence:GTACCGGCAGTGCTATGTTACTGCAATGCTCGAGCATTGCAGTAACATAGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005717.2-422s21c1
Sequence:CCGGCATTGTCTTGAAGGTGCTCATCTCGAGATGAGCACCTTCAAGACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005717.2-474s21c1
Sequence:CCGGGTTCAATCTCTGGACAAGAATCTCGAGATTCTTGTCCAGAGATTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005717.2-236s21c1
Sequence:CCGGCGTGGATGAATATGACGAGAACTCGAGTTCTCGTCATATTCATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005717.2-1077s21c1
Sequence:CCGGTGAGAGACTGGCAGCTATTAACTCGAGTTAATAGCTGCCAGTCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_005717.2-501s21c1
Sequence:CCGGGATCTCCTAATGAAGTATATTCTCGAGAATATACTTCATTAGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks