EMAIL THIS PAGE TO A FRIEND

ARPC5L

actin related protein 2/3 complex, subunit 5-like

70 Gene Product Result for
Synonyms: ARC16-2
UniProtKB ID: Q9BPX5, Q7Z523
Gene ID:
Mouse(74192) actin related protein 2/3 complex, subunit 5-like
Rat(296710) actin related protein 2/3 complex, subunit 5-like
chicken(101752218) actin related protein 2/3 complex, subunit 5-like
dog(612856) actin related protein 2/3 complex, subunit 5-like
cow(613421) actin related protein 2/3 complex, subunit 5-like
domestic cat(101082020) actin related protein 2/3 complex, subunit 5-like
naked mole-rat(101716608) actin related protein 2/3 complex, subunit 5-like
domestic guinea pig(100733699) actin related protein 2/3 complex, subunit 5-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028809 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028809 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028809 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030978 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030978 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030978 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU088731 MISSION® esiRNA esiRNA human ARPC5L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030978 Rosetta Predictions human pricing
NM_001037767 Rosetta Predictions rat pricing
NM_028809 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098738 predicted 794
2 SASI_Hs01_00098739 predicted 761
3 SASI_Hs01_00098740 predicted 755
4 SASI_Hs01_00098741 predicted 763
5 SASI_Hs01_00098737 predicted 797
6 SASI_Hs01_00098742 predicted 795
7 SASI_Hs01_00098743 predicted 799
8 SASI_Hs01_00098744 predicted 990
9 SASI_Hs01_00098745 predicted 854
10 SASI_Hs01_00098746 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037767 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078964 predicted 909
2 SASI_Rn01_00078965 predicted 419
3 SASI_Rn02_00204552 predicted 434
4 SASI_Rn01_00078966 predicted 431
5 SASI_Rn01_00078967 predicted 897
6 SASI_Rn01_00078968 predicted 904
7 SASI_Rn01_00078970 predicted 899
8 SASI_Rn01_00078972 predicted 427
9 SASI_Rn01_00078973 predicted 870
10 SASI_Rn02_00204553 predicted 384
11 SASI_Rn01_00078969 predicted 436
12 SASI_Rn01_00078971 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028809 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090609 predicted 966
2 SASI_Mm01_00090610 predicted 278
3 SASI_Mm01_00090611 predicted 288
4 SASI_Mm01_00090612 predicted 295
5 SASI_Mm01_00090613 predicted 978
6 SASI_Mm02_00334424 predicted 967
7 SASI_Mm01_00090614 predicted 245
8 SASI_Mm01_00090615 predicted 989
9 SASI_Mm01_00090616 predicted 889
10 SASI_Mm01_00090617 predicted 808
11 SASI_Mm01_00090618 predicted 891
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028809
ARPC5L MISSION shRNA Bacterial Glycerol Stock
actin related protein 2/3 complex, subunit 5-like
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028809.1-292s21c1
Sequence:CCGGGGTGTAGTCCTGAAAGTACTCCTCGAGGAGTACTTTCAGGACTACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028809.1-997s1c1
Sequence:CCGGCGGTGTGTTCTCTGTATGTTACTCGAGTAACATACAGAGAACACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028809.1-362s1c1
Sequence:CCGGGAAATGGCATTGATTTGCTAACTCGAGTTAGCAAATCAATGCCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028809.1-479s1c1
Sequence:CCGGGCTCCATTATAAGAGTTCTTACTCGAGTAAGAACTCTTATAATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028809.1-91s1c1
Sequence:CCGGCGCGTGGATATCGACGAATTTCTCGAGAAATTCGTCGATATCCACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028809.1-314s1c1
Sequence:CCGGCAAACTTTAAGAGCAGCGAAACTCGAGTTTCGCTGCTCTTAAAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028809
ARPC5L MISSION shRNA shRNA Plasmid DNA
actin related protein 2/3 complex, subunit 5-like
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028809.1-292s21c1
Sequence:CCGGGGTGTAGTCCTGAAAGTACTCCTCGAGGAGTACTTTCAGGACTACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028809.1-997s1c1
Sequence:CCGGCGGTGTGTTCTCTGTATGTTACTCGAGTAACATACAGAGAACACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028809.1-362s1c1
Sequence:CCGGGAAATGGCATTGATTTGCTAACTCGAGTTAGCAAATCAATGCCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028809.1-479s1c1
Sequence:CCGGGCTCCATTATAAGAGTTCTTACTCGAGTAAGAACTCTTATAATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028809.1-91s1c1
Sequence:CCGGCGCGTGGATATCGACGAATTTCTCGAGAAATTCGTCGATATCCACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028809.1-314s1c1
Sequence:CCGGCAAACTTTAAGAGCAGCGAAACTCGAGTTTCGCTGCTCTTAAAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028809
ARPC5L MISSION shRNA Lentiviral Transduction Particles
actin related protein 2/3 complex, subunit 5-like
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028809.1-292s21c1
Sequence:CCGGGGTGTAGTCCTGAAAGTACTCCTCGAGGAGTACTTTCAGGACTACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028809.1-997s1c1
Sequence:CCGGCGGTGTGTTCTCTGTATGTTACTCGAGTAACATACAGAGAACACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028809.1-362s1c1
Sequence:CCGGGAAATGGCATTGATTTGCTAACTCGAGTTAGCAAATCAATGCCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028809.1-479s1c1
Sequence:CCGGGCTCCATTATAAGAGTTCTTACTCGAGTAAGAACTCTTATAATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028809.1-91s1c1
Sequence:CCGGCGCGTGGATATCGACGAATTTCTCGAGAAATTCGTCGATATCCACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028809.1-314s1c1
Sequence:CCGGCAAACTTTAAGAGCAGCGAAACTCGAGTTTCGCTGCTCTTAAAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030978
VALIDATED
ARPC5L MISSION shRNA Bacterial Glycerol Stock
actin related protein 2/3 complex, subunit 5-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030978.1-397s21c1
Sequence:CCGGGCGTTGACTTGTTAATGAAGTCTCGAGACTTCATTAACAAGTCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030978.1-735s21c1
Sequence:CCGGGATCTGATAGTCTATGCCTTTCTCGAGAAAGGCATAGACTATCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030978.1-711s21c1
Sequence:CCGGGTCTGTTTCCTAAATCCTGTTCTCGAGAACAGGATTTAGGAAACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030978.1-332s21c1
Sequence:CCGGGAAAGTGCTCACAAACTTCAACTCGAGTTGAAGTTTGTGAGCACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030978.1-397s1c1
Sequence:CCGGGCGTTGACTTGTTAATGAAGTCTCGAGACTTCATTAACAAGTCAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030978.1-525s1c1
Sequence:CCGGCTTACAGCAAGAAAGACTGTTCTCGAGAACAGTCTTTCTTGCTGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030978.1-735s1c1
Sequence:CCGGGATCTGATAGTCTATGCCTTTCTCGAGAAAGGCATAGACTATCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030978.1-332s1c1
Sequence:CCGGGAAAGTGCTCACAAACTTCAACTCGAGTTGAAGTTTGTGAGCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030978.1-711s1c1
Sequence:CCGGGTCTGTTTCCTAAATCCTGTTCTCGAGAACAGGATTTAGGAAACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030978
VALIDATED
ARPC5L MISSION shRNA shRNA Plasmid DNA
actin related protein 2/3 complex, subunit 5-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030978.1-397s21c1
Sequence:CCGGGCGTTGACTTGTTAATGAAGTCTCGAGACTTCATTAACAAGTCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030978.1-735s21c1
Sequence:CCGGGATCTGATAGTCTATGCCTTTCTCGAGAAAGGCATAGACTATCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030978.1-711s21c1
Sequence:CCGGGTCTGTTTCCTAAATCCTGTTCTCGAGAACAGGATTTAGGAAACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030978.1-332s21c1
Sequence:CCGGGAAAGTGCTCACAAACTTCAACTCGAGTTGAAGTTTGTGAGCACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030978.1-397s1c1
Sequence:CCGGGCGTTGACTTGTTAATGAAGTCTCGAGACTTCATTAACAAGTCAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030978.1-525s1c1
Sequence:CCGGCTTACAGCAAGAAAGACTGTTCTCGAGAACAGTCTTTCTTGCTGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030978.1-735s1c1
Sequence:CCGGGATCTGATAGTCTATGCCTTTCTCGAGAAAGGCATAGACTATCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030978.1-332s1c1
Sequence:CCGGGAAAGTGCTCACAAACTTCAACTCGAGTTGAAGTTTGTGAGCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030978.1-711s1c1
Sequence:CCGGGTCTGTTTCCTAAATCCTGTTCTCGAGAACAGGATTTAGGAAACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030978
VALIDATED
ARPC5L MISSION shRNA Lentiviral Transduction Particles
actin related protein 2/3 complex, subunit 5-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030978.1-397s21c1
Sequence:CCGGGCGTTGACTTGTTAATGAAGTCTCGAGACTTCATTAACAAGTCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030978.1-735s21c1
Sequence:CCGGGATCTGATAGTCTATGCCTTTCTCGAGAAAGGCATAGACTATCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030978.1-711s21c1
Sequence:CCGGGTCTGTTTCCTAAATCCTGTTCTCGAGAACAGGATTTAGGAAACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030978.1-332s21c1
Sequence:CCGGGAAAGTGCTCACAAACTTCAACTCGAGTTGAAGTTTGTGAGCACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030978.1-397s1c1
Sequence:CCGGGCGTTGACTTGTTAATGAAGTCTCGAGACTTCATTAACAAGTCAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030978.1-525s1c1
Sequence:CCGGCTTACAGCAAGAAAGACTGTTCTCGAGAACAGTCTTTCTTGCTGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030978.1-735s1c1
Sequence:CCGGGATCTGATAGTCTATGCCTTTCTCGAGAAAGGCATAGACTATCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030978.1-332s1c1
Sequence:CCGGGAAAGTGCTCACAAACTTCAACTCGAGTTGAAGTTTGTGAGCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030978.1-711s1c1
Sequence:CCGGGTCTGTTTCCTAAATCCTGTTCTCGAGAACAGGATTTAGGAAACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks