EMAIL THIS PAGE TO A FRIEND

ARPP19

cAMP-regulated phosphoprotein, 19kDa

Synonyms: ARPP-16 ARPP-19 ARPP16 ENSAL
UniProtKB ID: P56211, B2R497, Q6IAM2, Q86TA6, Q9UD70
Gene ID:
Human(10776) Summary: The 19-kD cAMP-regulated phosphoprotein plays a role in regulating mitosis by inhibiting protein phosphatase-2A (PP2A; see MIM 176915) (summary by Gharbi-Ayachi et al., 2010 [PubMed 21164014]
Mouse(59046) cAMP-regulated phosphoprotein 19
Rat(60336) cAMP-regulated phosphoprotein 19
chicken(768853) cAMP-regulated phosphoprotein, 19kDa
dog(487556) cAMP-regulated phosphoprotein, 19kDa
cow(282658) cAMP-regulated phosphoprotein, 19kDa
domestic cat(101092768) cAMP-regulated phosphoprotein, 19kDa
domestic guinea pig(100723464) cAMP-regulated phosphoprotein, 19kDa
sheep(101102906) cAMP-regulated phosphoprotein, 19kDa
176 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021548 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021548 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021548 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006628 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006628 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006628 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006628 Rosetta Predictions human pricing
NM_031660 Rosetta Predictions rat pricing
NM_021548 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341974 predicted 478
2 SASI_Hs01_00151963 predicted 484
3 SASI_Hs01_00151964 predicted 936
4 SASI_Hs02_00341975 predicted 600
5 SASI_Hs02_00341976 predicted 453
6 SASI_Hs02_00341977 predicted 939
7 SASI_Hs01_00151959 predicted 841
8 SASI_Hs01_00151960 predicted 958
9 SASI_Hs01_00151961 predicted 956
10 SASI_Hs01_00151962 predicted 668
11 SASI_Hs01_00151965 predicted 568
12 SASI_Hs01_00151966 predicted 592
13 SASI_Hs01_00151967 predicted 709
14 SASI_Hs01_00151968 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031660 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088439 predicted 293
2 SASI_Rn01_00088440 predicted 37
3 SASI_Rn01_00088441 predicted 280
4 SASI_Rn01_00088442 predicted 95
5 SASI_Rn01_00088443 predicted 70
6 SASI_Rn01_00088444 predicted 301
7 SASI_Rn01_00088445 predicted 123
8 SASI_Rn01_00088446 predicted 298
9 SASI_Rn01_00088447 predicted 276
10 SASI_Rn01_00088448 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021548 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035885 predicted 853
2 SASI_Mm01_00035888 predicted 742
3 SASI_Mm01_00035889 predicted 662
4 SASI_Mm02_00326302 predicted 616
5 SASI_Mm02_00326303 predicted 713
6 SASI_Mm01_00035892 predicted 583
7 SASI_Mm01_00035893 predicted 653
8 SASI_Mm02_00326304 predicted 759
9 SASI_Mm02_00326305 predicted 576
10 SASI_Mm02_00326306 predicted 962
11 SASI_Mm01_00035886 predicted 236
12 SASI_Mm01_00035887 predicted 963
13 SASI_Mm01_00035890 predicted 891
14 SASI_Mm01_00035891 predicted 734
15 SASI_Mm01_00035894 predicted 292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021548
VALIDATED
ARPP19 MISSION shRNA Bacterial Glycerol Stock
cAMP-regulated phosphoprotein, 19kDa
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021548.3-246s1c1
Sequence:CCGGGTAACTAGTCCAGAGAAAGCTCTCGAGAGCTTTCTCTGGACTAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021548.3-256s1c1
Sequence:CCGGCAGAGAAAGCTGAAGAAGCAACTCGAGTTGCTTCTTCAGCTTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021548.4-230s21c1
Sequence:CCGGGGAAATGGAAGATAAAGTAACCTCGAGGTTACTTTATCTTCCATTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021548.4-274s21c1
Sequence:CCGGCAAAGTTAAAGGCAAGGTATCCTCGAGGATACCTTGCCTTTAACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021548.4-1960s21c1
Sequence:CCGGCTAGGTGAGTAGGGCTAATAACTCGAGTTATTAGCCCTACTCACCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021548.4-509s21c1
Sequence:CCGGCAAGCTGGCTGGCTGATTAAACTCGAGTTTAATCAGCCAGCCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216420    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021548.4-2396s1c1
Sequence:CCGGGTAATGAGCAAACGAATTATTCTCGAGAATAATTCGTTTGCTCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021548.4-430s21c1
Sequence:CCGGCGGATAAGACAGAGGTCACTGCTCGAGCAGTGACCTCTGTCTTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021548
VALIDATED
ARPP19 MISSION shRNA shRNA Plasmid DNA
cAMP-regulated phosphoprotein, 19kDa
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021548.3-246s1c1
Sequence:CCGGGTAACTAGTCCAGAGAAAGCTCTCGAGAGCTTTCTCTGGACTAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021548.3-256s1c1
Sequence:CCGGCAGAGAAAGCTGAAGAAGCAACTCGAGTTGCTTCTTCAGCTTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021548.4-230s21c1
Sequence:CCGGGGAAATGGAAGATAAAGTAACCTCGAGGTTACTTTATCTTCCATTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021548.4-274s21c1
Sequence:CCGGCAAAGTTAAAGGCAAGGTATCCTCGAGGATACCTTGCCTTTAACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021548.4-1960s21c1
Sequence:CCGGCTAGGTGAGTAGGGCTAATAACTCGAGTTATTAGCCCTACTCACCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021548.4-509s21c1
Sequence:CCGGCAAGCTGGCTGGCTGATTAAACTCGAGTTTAATCAGCCAGCCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216420    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021548.4-2396s1c1
Sequence:CCGGGTAATGAGCAAACGAATTATTCTCGAGAATAATTCGTTTGCTCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021548.4-430s21c1
Sequence:CCGGCGGATAAGACAGAGGTCACTGCTCGAGCAGTGACCTCTGTCTTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021548
VALIDATED
ARPP19 MISSION shRNA Lentiviral Transduction Particles
cAMP-regulated phosphoprotein, 19kDa
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021548.3-246s1c1
Sequence:CCGGGTAACTAGTCCAGAGAAAGCTCTCGAGAGCTTTCTCTGGACTAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021548.3-256s1c1
Sequence:CCGGCAGAGAAAGCTGAAGAAGCAACTCGAGTTGCTTCTTCAGCTTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021548.4-230s21c1
Sequence:CCGGGGAAATGGAAGATAAAGTAACCTCGAGGTTACTTTATCTTCCATTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021548.4-274s21c1
Sequence:CCGGCAAAGTTAAAGGCAAGGTATCCTCGAGGATACCTTGCCTTTAACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021548.4-1960s21c1
Sequence:CCGGCTAGGTGAGTAGGGCTAATAACTCGAGTTATTAGCCCTACTCACCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021548.4-509s21c1
Sequence:CCGGCAAGCTGGCTGGCTGATTAAACTCGAGTTTAATCAGCCAGCCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216420    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021548.4-2396s1c1
Sequence:CCGGGTAATGAGCAAACGAATTATTCTCGAGAATAATTCGTTTGCTCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_021548.4-430s21c1
Sequence:CCGGCGGATAAGACAGAGGTCACTGCTCGAGCAGTGACCTCTGTCTTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006628
VALIDATED
ARPP19 MISSION shRNA Bacterial Glycerol Stock
cAMP-regulated phosphoprotein, 19kDa
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006628.3-158s1c1
Sequence:CCGGGAGGAGCAGAAGGAAATGGAACTCGAGTTCCATTTCCTTCTGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006628.3-1205s1c1
Sequence:CCGGCCTCTCACAAATGTCTGTATTCTCGAGAATACAGACATTTGTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006628.3-163s1c1
Sequence:CCGGGCAGAAGGAAATGGAAGATAACTCGAGTTATCTTCCATTTCCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159192    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006628.3-3052s1c1
Sequence:CCGGGCTCAGTTTATTGAAGACATTCTCGAGAATGTCTTCAATAAACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006628.3-170s1c1
Sequence:CCGGGAAATGGAAGATAAAGTGACTCTCGAGAGTCACTTTATCTTCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006628.3-228s1c1
Sequence:CCGGGATATCCTCATCTGGGACAAACTCGAGTTTGTCCCAGATGAGGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006628.3-252s1c1
Sequence:CCGGCTGGAGGTTCAGATTTCTTAACTCGAGTTAAGAAATCTGAACCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006628.3-4575s1c1
Sequence:CCGGGCCACAATTTAGGACACATTTCTCGAGAAATGTGTCCTAAATTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006628.3-164s1c1
Sequence:CCGGCAGAAGGAAATGGAAGATAAACTCGAGTTTATCTTCCATTTCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006628.3-314s1c1
Sequence:CCGGGATTACAACATGGCTAAAGCACTCGAGTGCTTTAGCCATGTTGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161386    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006628.3-2382s1c1
Sequence:CCGGGCCTCAAACATAGCACCTTAACTCGAGTTAAGGTGCTATGTTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006628.3-268s1c1
Sequence:CCGGCTTAAGGAAACGGTTGCAGAACTCGAGTTCTGCAACCGTTTCCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006628.4-163s21c1
Sequence:CCGGGCAGAAGGAAATGGAAGATAACTCGAGTTATCTTCCATTTCCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006628.4-252s21c1
Sequence:CCGGCTGGAGGTTCAGATTTCTTAACTCGAGTTAAGAAATCTGAACCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006628.4-268s21c1
Sequence:CCGGCTTAAGGAAACGGTTGCAGAACTCGAGTTCTGCAACCGTTTCCTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006628.4-228s21c1
Sequence:CCGGGATATCCTCATCTGGGACAAACTCGAGTTTGTCCCAGATGAGGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006628.4-314s21c1
Sequence:CCGGGATTACAACATGGCTAAAGCACTCGAGTGCTTTAGCCATGTTGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006628
VALIDATED
ARPP19 MISSION shRNA shRNA Plasmid DNA
cAMP-regulated phosphoprotein, 19kDa
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006628.3-158s1c1
Sequence:CCGGGAGGAGCAGAAGGAAATGGAACTCGAGTTCCATTTCCTTCTGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006628.3-1205s1c1
Sequence:CCGGCCTCTCACAAATGTCTGTATTCTCGAGAATACAGACATTTGTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006628.3-163s1c1
Sequence:CCGGGCAGAAGGAAATGGAAGATAACTCGAGTTATCTTCCATTTCCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159192    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006628.3-3052s1c1
Sequence:CCGGGCTCAGTTTATTGAAGACATTCTCGAGAATGTCTTCAATAAACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006628.3-170s1c1
Sequence:CCGGGAAATGGAAGATAAAGTGACTCTCGAGAGTCACTTTATCTTCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006628.3-228s1c1
Sequence:CCGGGATATCCTCATCTGGGACAAACTCGAGTTTGTCCCAGATGAGGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006628.3-252s1c1
Sequence:CCGGCTGGAGGTTCAGATTTCTTAACTCGAGTTAAGAAATCTGAACCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006628.3-4575s1c1
Sequence:CCGGGCCACAATTTAGGACACATTTCTCGAGAAATGTGTCCTAAATTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006628.3-164s1c1
Sequence:CCGGCAGAAGGAAATGGAAGATAAACTCGAGTTTATCTTCCATTTCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006628.3-314s1c1
Sequence:CCGGGATTACAACATGGCTAAAGCACTCGAGTGCTTTAGCCATGTTGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161386    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006628.3-2382s1c1
Sequence:CCGGGCCTCAAACATAGCACCTTAACTCGAGTTAAGGTGCTATGTTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006628.3-268s1c1
Sequence:CCGGCTTAAGGAAACGGTTGCAGAACTCGAGTTCTGCAACCGTTTCCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006628.4-163s21c1
Sequence:CCGGGCAGAAGGAAATGGAAGATAACTCGAGTTATCTTCCATTTCCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006628.4-252s21c1
Sequence:CCGGCTGGAGGTTCAGATTTCTTAACTCGAGTTAAGAAATCTGAACCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006628.4-268s21c1
Sequence:CCGGCTTAAGGAAACGGTTGCAGAACTCGAGTTCTGCAACCGTTTCCTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006628.4-228s21c1
Sequence:CCGGGATATCCTCATCTGGGACAAACTCGAGTTTGTCCCAGATGAGGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006628.4-314s21c1
Sequence:CCGGGATTACAACATGGCTAAAGCACTCGAGTGCTTTAGCCATGTTGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006628
VALIDATED
ARPP19 MISSION shRNA Lentiviral Transduction Particles
cAMP-regulated phosphoprotein, 19kDa
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006628.3-158s1c1
Sequence:CCGGGAGGAGCAGAAGGAAATGGAACTCGAGTTCCATTTCCTTCTGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006628.3-1205s1c1
Sequence:CCGGCCTCTCACAAATGTCTGTATTCTCGAGAATACAGACATTTGTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006628.3-163s1c1
Sequence:CCGGGCAGAAGGAAATGGAAGATAACTCGAGTTATCTTCCATTTCCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159192    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006628.3-3052s1c1
Sequence:CCGGGCTCAGTTTATTGAAGACATTCTCGAGAATGTCTTCAATAAACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006628.3-170s1c1
Sequence:CCGGGAAATGGAAGATAAAGTGACTCTCGAGAGTCACTTTATCTTCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006628.3-228s1c1
Sequence:CCGGGATATCCTCATCTGGGACAAACTCGAGTTTGTCCCAGATGAGGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006628.3-252s1c1
Sequence:CCGGCTGGAGGTTCAGATTTCTTAACTCGAGTTAAGAAATCTGAACCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006628.3-4575s1c1
Sequence:CCGGGCCACAATTTAGGACACATTTCTCGAGAAATGTGTCCTAAATTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006628.3-164s1c1
Sequence:CCGGCAGAAGGAAATGGAAGATAAACTCGAGTTTATCTTCCATTTCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006628.3-314s1c1
Sequence:CCGGGATTACAACATGGCTAAAGCACTCGAGTGCTTTAGCCATGTTGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161386    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006628.3-2382s1c1
Sequence:CCGGGCCTCAAACATAGCACCTTAACTCGAGTTAAGGTGCTATGTTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006628.3-268s1c1
Sequence:CCGGCTTAAGGAAACGGTTGCAGAACTCGAGTTCTGCAACCGTTTCCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006628.4-163s21c1
Sequence:CCGGGCAGAAGGAAATGGAAGATAACTCGAGTTATCTTCCATTTCCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006628.4-252s21c1
Sequence:CCGGCTGGAGGTTCAGATTTCTTAACTCGAGTTAAGAAATCTGAACCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006628.4-268s21c1
Sequence:CCGGCTTAAGGAAACGGTTGCAGAACTCGAGTTCTGCAACCGTTTCCTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006628.4-228s21c1
Sequence:CCGGGATATCCTCATCTGGGACAAACTCGAGTTTGTCCCAGATGAGGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006628.4-314s21c1
Sequence:CCGGGATTACAACATGGCTAAAGCACTCGAGTGCTTTAGCCATGTTGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks