EMAIL THIS PAGE TO A FRIEND

ARPP21

cAMP-regulated phosphoprotein, 21kDa

313 Gene Product Result for
Synonyms: ARPP-21 R3HDM3 RCS TARPP
Gene ID:
Human(10777) Summary: This gene encodes a cAMP-regulated phosphoprotein. The encoded protein is enriched in the caudate nucleus and cerebellar cortex. A similar protein in mouse may be involved in regulating the effects of dopamine in the basal ganglia. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Mouse(74100) cyclic AMP-regulated phosphoprotein, 21
Rat(363153) cAMP-regulated phosphoprotein 21
Zebrafish(564134) cyclic AMP-regulated phosphoprotein, 21
dog(477016) cAMP-regulated phosphoprotein, 21kDa
chicken(428459) cAMP-regulated phosphoprotein, 21kDa
domestic cat(101090041) cAMP-regulated phosphoprotein, 21kDa
cow(618648) cAMP-regulated phosphoprotein, 21kDa
Horse(100050660) cAMP-regulated phosphoprotein, 21kDa
sheep(101106887) cAMP-regulated phosphoprotein, 21kDa
naked mole-rat(101722707) cAMP-regulated phosphoprotein, 21kDa
domestic guinea pig(100719243) cAMP-regulated phosphoprotein, 21kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108088 Anti-ARPP-21 antibody produced in rabbit affinity isolated antibody canine, rabbit, yeast, bovine, human, guinea pig, rat, mouse, horse
western blot pricing
SAB2100155 Anti-ARPP-21 antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse, rat, canine, bovine, rabbit, chicken, yeast, horse, human
western blot pricing
SAB4500158 Anti-ARPP21 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB2106567 Anti-ARPP21 antibody produced in rabbit affinity isolated antibody rabbit, guinea pig, horse, human, mouse
ELISA, western blot pricing
SAB2106568 Anti-ARPP21 antibody produced in rabbit affinity isolated antibody mouse, guinea pig, horse, rabbit, human
ELISA, western blot pricing
HPA017303 ANTI-ARPP21 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198399 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198399 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198399 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028755 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028755 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028755 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033264 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033264 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033264 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092521 MISSION® esiRNA esiRNA human ARPP-21 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025068 Rosetta Predictions human pricing
NM_001025069 Rosetta Predictions human pricing
NM_016300 Rosetta Predictions human pricing
NM_198399 Rosetta Predictions human pricing
XM_343492 Rosetta Predictions rat pricing
NM_028755 Rosetta Predictions mouse pricing
NM_033264 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025068 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242063 predicted 657
2 SASI_Hs01_00242061 predicted 515
3 SASI_Hs01_00242062 predicted 687
4 SASI_Hs01_00242064 predicted 1001
5 SASI_Hs01_00242065 predicted 866
6 SASI_Hs01_00242066 predicted 741
7 SASI_Hs01_00242067 predicted 774
8 SASI_Hs01_00242069 predicted 1034
9 SASI_Hs02_00307310 predicted 676
10 SASI_Hs01_00242070 predicted 1028
11 SASI_Hs01_00242068 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025069 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025489 predicted 664
2 SASI_Hs01_00025487 predicted 523
3 SASI_Hs01_00025488 predicted 696
4 SASI_Hs01_00025490 predicted 1011
5 SASI_Hs01_00025491 predicted 879
6 SASI_Hs01_00025492 predicted 754
7 SASI_Hs01_00025493 predicted 789
8 SASI_Hs01_00025495 predicted 1040
9 SASI_Hs02_00307311 predicted 685
10 SASI_Hs01_00025496 predicted 1041
11 SASI_Hs01_00025494 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062675 predicted 2291
2 SASI_Hs01_00062676 predicted 2780
3 SASI_Hs01_00062677 predicted 1898
4 SASI_Hs01_00062678 predicted 2387
5 SASI_Hs01_00062679 predicted 2549
6 SASI_Hs01_00062680 predicted 1734
7 SASI_Hs01_00062681 predicted 1367
8 SASI_Hs01_00062682 predicted 1218
9 SASI_Hs01_00062683 predicted 2300
10 SASI_Hs01_00062684 predicted 1199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147384 predicted 645
2 SASI_Hs01_00147382 predicted 512
3 SASI_Hs01_00147383 predicted 673
4 SASI_Hs01_00147385 predicted 993
5 SASI_Hs01_00147386 predicted 856
6 SASI_Hs01_00147387 predicted 735
7 SASI_Hs01_00147388 predicted 769
8 SASI_Hs01_00147390 predicted 1027
9 SASI_Hs02_00371916 predicted 668
10 SASI_Hs01_00147391 predicted 1015
11 SASI_Hs01_00147389 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343492 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395864 predicted 2403
2 SASI_Rn02_00395865 predicted 2153
3 SASI_Rn02_00395866 predicted 381
4 SASI_Rn02_00395867 predicted 2477
5 SASI_Rn02_00395868 predicted 603
6 SASI_Rn02_00395869 predicted 787
7 SASI_Rn02_00395870 predicted 951
8 SASI_Rn02_00395871 predicted 435
9 SASI_Rn02_00395872 predicted 1316
10 SASI_Rn02_00395873 predicted 1376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028755 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134790 predicted 279
2 SASI_Mm01_00134792 predicted 718
3 SASI_Mm01_00134793 predicted 926
4 SASI_Mm02_00334336 predicted 455
5 SASI_Mm01_00134794 predicted 914
6 SASI_Mm01_00134795 predicted 619
7 SASI_Mm01_00134796 predicted 677
8 SASI_Mm01_00134797 predicted 704
9 SASI_Mm01_00134798 predicted 644
10 SASI_Mm01_00134799 predicted 511
11 SASI_Mm01_00134791 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033264 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146123 predicted 2469
2 SASI_Mm01_00146124 predicted 683
3 SASI_Mm01_00146125 predicted 587
4 SASI_Mm02_00337317 predicted 365
5 SASI_Mm01_00146126 predicted 603
6 SASI_Mm01_00146127 predicted 963
7 SASI_Mm01_00146128 predicted 2534
8 SASI_Mm01_00146129 predicted 1120
9 SASI_Mm01_00146131 predicted 1487
10 SASI_Mm01_00146132 predicted 437
11 SASI_Mm01_00146130 predicted 489
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198399
VALIDATED
ARPP21 MISSION shRNA Bacterial Glycerol Stock
cAMP-regulated phosphoprotein, 21kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198399.1-341s21c1
Sequence:CCGGTCCAGAGAACGGCATTGTTAACTCGAGTTAACAATGCCGTTCTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198399.1-1503s21c1
Sequence:CCGGTGTGAATATCACGGCTTATATCTCGAGATATAAGCCGTGATATTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198399.1-515s21c1
Sequence:CCGGTGAAAGTCTTCAGGATCAGACCTCGAGGTCTGATCCTGAAGACTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198399.1-410s21c1
Sequence:CCGGGGAGGCTCAGAATCAAGAAAGCTCGAGCTTTCTTGATTCTGAGCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198399.1-479s21c1
Sequence:CCGGTGCTGTCTGTGAGGAATCTTCCTCGAGGAAGATTCCTCACAGACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198399.1-1775s1c1
Sequence:CCGGGCAGAGAAATAAGGTGTAAATCTCGAGATTTACACCTTATTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198399.1-412s1c1
Sequence:CCGGAGGCTCAGAATCAAGAAAGAACTCGAGTTCTTTCTTGATTCTGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198399.1-339s1c1
Sequence:CCGGACTCCAGAGAACGGCATTGTTCTCGAGAACAATGCCGTTCTCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_198399.1-511s1c1
Sequence:CCGGGAGGTGAAAGTCTTCAGGATCCTCGAGGATCCTGAAGACTTTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198399.1-480s1c1
Sequence:CCGGGCTGTCTGTGAGGAATCTTCTCTCGAGAGAAGATTCCTCACAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198399
VALIDATED
ARPP21 MISSION shRNA shRNA Plasmid DNA
cAMP-regulated phosphoprotein, 21kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198399.1-341s21c1
Sequence:CCGGTCCAGAGAACGGCATTGTTAACTCGAGTTAACAATGCCGTTCTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198399.1-1503s21c1
Sequence:CCGGTGTGAATATCACGGCTTATATCTCGAGATATAAGCCGTGATATTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198399.1-515s21c1
Sequence:CCGGTGAAAGTCTTCAGGATCAGACCTCGAGGTCTGATCCTGAAGACTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198399.1-410s21c1
Sequence:CCGGGGAGGCTCAGAATCAAGAAAGCTCGAGCTTTCTTGATTCTGAGCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198399.1-479s21c1
Sequence:CCGGTGCTGTCTGTGAGGAATCTTCCTCGAGGAAGATTCCTCACAGACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198399.1-1775s1c1
Sequence:CCGGGCAGAGAAATAAGGTGTAAATCTCGAGATTTACACCTTATTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198399.1-412s1c1
Sequence:CCGGAGGCTCAGAATCAAGAAAGAACTCGAGTTCTTTCTTGATTCTGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198399.1-339s1c1
Sequence:CCGGACTCCAGAGAACGGCATTGTTCTCGAGAACAATGCCGTTCTCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_198399.1-511s1c1
Sequence:CCGGGAGGTGAAAGTCTTCAGGATCCTCGAGGATCCTGAAGACTTTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198399.1-480s1c1
Sequence:CCGGGCTGTCTGTGAGGAATCTTCTCTCGAGAGAAGATTCCTCACAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198399
VALIDATED
ARPP21 MISSION shRNA Lentiviral Transduction Particles
cAMP-regulated phosphoprotein, 21kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198399.1-341s21c1
Sequence:CCGGTCCAGAGAACGGCATTGTTAACTCGAGTTAACAATGCCGTTCTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198399.1-1503s21c1
Sequence:CCGGTGTGAATATCACGGCTTATATCTCGAGATATAAGCCGTGATATTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198399.1-515s21c1
Sequence:CCGGTGAAAGTCTTCAGGATCAGACCTCGAGGTCTGATCCTGAAGACTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198399.1-410s21c1
Sequence:CCGGGGAGGCTCAGAATCAAGAAAGCTCGAGCTTTCTTGATTCTGAGCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198399.1-479s21c1
Sequence:CCGGTGCTGTCTGTGAGGAATCTTCCTCGAGGAAGATTCCTCACAGACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198399.1-1775s1c1
Sequence:CCGGGCAGAGAAATAAGGTGTAAATCTCGAGATTTACACCTTATTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198399.1-412s1c1
Sequence:CCGGAGGCTCAGAATCAAGAAAGAACTCGAGTTCTTTCTTGATTCTGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198399.1-339s1c1
Sequence:CCGGACTCCAGAGAACGGCATTGTTCTCGAGAACAATGCCGTTCTCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_198399.1-511s1c1
Sequence:CCGGGAGGTGAAAGTCTTCAGGATCCTCGAGGATCCTGAAGACTTTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198399.1-480s1c1
Sequence:CCGGGCTGTCTGTGAGGAATCTTCTCTCGAGAGAAGATTCCTCACAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028755
ARPP21 MISSION shRNA Bacterial Glycerol Stock
cAMP-regulated phosphoprotein, 21kDa
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028755.2-474s1c1
Sequence:CCGGGCTGTCTGTGAAGAGTCTTCACTCGAGTGAAGACTCTTCACAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028755.2-920s1c1
Sequence:CCGGGCTACATATCTCCACCCTTATCTCGAGATAAGGGTGGAGATATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177364    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028755.2-542s1c1
Sequence:CCGGGCAAATGGAAAGGAACTCAAACTCGAGTTTGAGTTCCTTTCCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028755.2-483s1c1
Sequence:CCGGGAAGAGTCTTCAGCTAGATCTCTCGAGAGATCTAGCTGAAGACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028755.2-464s1c1
Sequence:CCGGCAGAAGTCTTGCTGTCTGTGACTCGAGTCACAGACAGCAAGACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028755.2-347s1c1
Sequence:CCGGCATCCTCAAGTCAGAAAGTCTCTCGAGAGACTTTCTGACTTGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028755.2-510s1c1
Sequence:CCGGGAAAGTCACCAGGATCAGACTCTCGAGAGTCTGATCCTGGTGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028755.2-351s1c1
Sequence:CCGGCTCAAGTCAGAAAGTCTGGATCTCGAGATCCAGACTTTCTGACTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028755
ARPP21 MISSION shRNA shRNA Plasmid DNA
cAMP-regulated phosphoprotein, 21kDa
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028755.2-474s1c1
Sequence:CCGGGCTGTCTGTGAAGAGTCTTCACTCGAGTGAAGACTCTTCACAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028755.2-920s1c1
Sequence:CCGGGCTACATATCTCCACCCTTATCTCGAGATAAGGGTGGAGATATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177364    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028755.2-542s1c1
Sequence:CCGGGCAAATGGAAAGGAACTCAAACTCGAGTTTGAGTTCCTTTCCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028755.2-483s1c1
Sequence:CCGGGAAGAGTCTTCAGCTAGATCTCTCGAGAGATCTAGCTGAAGACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028755.2-464s1c1
Sequence:CCGGCAGAAGTCTTGCTGTCTGTGACTCGAGTCACAGACAGCAAGACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028755.2-347s1c1
Sequence:CCGGCATCCTCAAGTCAGAAAGTCTCTCGAGAGACTTTCTGACTTGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028755.2-510s1c1
Sequence:CCGGGAAAGTCACCAGGATCAGACTCTCGAGAGTCTGATCCTGGTGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028755.2-351s1c1
Sequence:CCGGCTCAAGTCAGAAAGTCTGGATCTCGAGATCCAGACTTTCTGACTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028755
ARPP21 MISSION shRNA Lentiviral Transduction Particles
cAMP-regulated phosphoprotein, 21kDa
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028755.2-474s1c1
Sequence:CCGGGCTGTCTGTGAAGAGTCTTCACTCGAGTGAAGACTCTTCACAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028755.2-920s1c1
Sequence:CCGGGCTACATATCTCCACCCTTATCTCGAGATAAGGGTGGAGATATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177364    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028755.2-542s1c1
Sequence:CCGGGCAAATGGAAAGGAACTCAAACTCGAGTTTGAGTTCCTTTCCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028755.2-483s1c1
Sequence:CCGGGAAGAGTCTTCAGCTAGATCTCTCGAGAGATCTAGCTGAAGACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028755.2-464s1c1
Sequence:CCGGCAGAAGTCTTGCTGTCTGTGACTCGAGTCACAGACAGCAAGACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028755.2-347s1c1
Sequence:CCGGCATCCTCAAGTCAGAAAGTCTCTCGAGAGACTTTCTGACTTGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028755.2-510s1c1
Sequence:CCGGGAAAGTCACCAGGATCAGACTCTCGAGAGTCTGATCCTGGTGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028755.2-351s1c1
Sequence:CCGGCTCAAGTCAGAAAGTCTGGATCTCGAGATCCAGACTTTCTGACTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033264
ARPP21 MISSION shRNA Bacterial Glycerol Stock
cAMP-regulated phosphoprotein, 21kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033264.1-2757s1c1
Sequence:CCGGGCTGGTTAATGGTGCATAATTCTCGAGAATTATGCACCATTAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033264.1-1589s1c1
Sequence:CCGGCCCGGAAGCATCCTTCTTAATCTCGAGATTAAGAAGGATGCTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033264.1-2473s1c1
Sequence:CCGGCCCTCAGAACAACCTAAGGTTCTCGAGAACCTTAGGTTGTTCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033264.1-682s1c1
Sequence:CCGGGCAGGAAATGATTGATTTCATCTCGAGATGAAATCAATCATTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033264.1-914s1c1
Sequence:CCGGCGGTTTATCTTGAAGCGAGATCTCGAGATCTCGCTTCAAGATAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033264
ARPP21 MISSION shRNA shRNA Plasmid DNA
cAMP-regulated phosphoprotein, 21kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033264.1-2757s1c1
Sequence:CCGGGCTGGTTAATGGTGCATAATTCTCGAGAATTATGCACCATTAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033264.1-1589s1c1
Sequence:CCGGCCCGGAAGCATCCTTCTTAATCTCGAGATTAAGAAGGATGCTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033264.1-2473s1c1
Sequence:CCGGCCCTCAGAACAACCTAAGGTTCTCGAGAACCTTAGGTTGTTCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033264.1-682s1c1
Sequence:CCGGGCAGGAAATGATTGATTTCATCTCGAGATGAAATCAATCATTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033264.1-914s1c1
Sequence:CCGGCGGTTTATCTTGAAGCGAGATCTCGAGATCTCGCTTCAAGATAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033264
ARPP21 MISSION shRNA Lentiviral Transduction Particles
cAMP-regulated phosphoprotein, 21kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033264.1-2757s1c1
Sequence:CCGGGCTGGTTAATGGTGCATAATTCTCGAGAATTATGCACCATTAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033264.1-1589s1c1
Sequence:CCGGCCCGGAAGCATCCTTCTTAATCTCGAGATTAAGAAGGATGCTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033264.1-2473s1c1
Sequence:CCGGCCCTCAGAACAACCTAAGGTTCTCGAGAACCTTAGGTTGTTCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033264.1-682s1c1
Sequence:CCGGGCAGGAAATGATTGATTTCATCTCGAGATGAAATCAATCATTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033264.1-914s1c1
Sequence:CCGGCGGTTTATCTTGAAGCGAGATCTCGAGATCTCGCTTCAAGATAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks